Why might farmers use artificial selection to develop different ypes of vegetables

Biology

1 answer:

Vesnalui [34]2 years ago

5 0

To enlarge crops or mix types for a different flavor ,pest control,or if a type of vegetable is fading away

You might be interested in

8. Which repair process leads to an abasic site as part of the repair pathway?

Levart [38]

Answer:

Explanation:

5 0

2 years ago

All movement are locomotion but not all locomotion are movement

Vladimir [108]

Some may assume that movement and locomotion are the same, but these two words have certain differences. Movement is known to be the time when a living organism will move from one place to another. Locomotion means that the movement that the living organism did has made changes to the current position of the organism.

7 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

3. What is the name of the process by which evolution occurs?

Free_Kalibri [48]

Answer:

Evolution is the process of genetic change from one generation to the next and may be caused by several methods. In essence, evolution occurs when some individuals or some alleles (gene types) reproduce themselves more than others,increasing their prevalence in subsequent generations.

Explanation:

8 0

2 years ago

Which organism contains organs?<br> ) <br> ) <br> ) <br> )

Illusion [34]

Answer:Any mammals or animals suck as lizards humans birds fish

Explanation:This is because we mammals require organs in order for our body to function

4 0

2 years ago