1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
topjm [15]
3 years ago
10

Describe Hemopure and explain how it is used.

Biology
2 answers:
AlexFokin [52]3 years ago
8 0

Answer:Hemopure is a blood substitute developed by Biopure Corporation. *consists of hemoglobin, purified from bovine blood, free in the plasma. *binds oxygen in the lungs then delivers oxygen to the body. *cell-free hemoglobin releases the oxygen more quickly than red blood cells. *risk of high blood pressure and heart attacks.

Explanation:

Aleonysh [2.5K]3 years ago
6 0

<u>ANSWER:</u>

Hemopure is a blood substitute that has been approved by the FDA. The blood substitute has been developed by Biopure Corporation.

<u>EXPLANATION:</u>

  • The main function of the blood substitute is to recreate the functions of blood in the body namely blood clotting and transporting oxygen.
  • Hemopure comes in bags and does not need to be refrigerated like donated blood. This blood can be transfused using needles and tubes. Hemopure contains bovine haemoglobin and can be used for patients who need blood.  

You might be interested in
Difference between air pollution and soil pollution ​
Misha Larkins [42]

Answer:

Soil pollution-  Soil pollution is defined as the presence of toxic chemicals in soil

it could pose a threat to humans, etc...

caused by the presence of xenobiotic chemicals

(A xenobiotic is a chemical substance found within an organism that is not naturally produced or expected to be present within the organism.)

or other alteration in the natural soil environment. It is typically caused by industrial activity, agricultural chemicals or improper disposal of waste.

Air pollution- Air pollution is a mixture of solid particles and gases in the air.

Car emissions, chemicals from factories, dust, pollen and mold spores may be suspended as particles.

Explanation:

4 0
3 years ago
Read 2 more answers
What would you expect from an exothermic reaction
otez555 [7]
A chemical reaction in which energy is released to its surroundings. It exits immediately
8 0
3 years ago
Read 2 more answers
Please help! I will give you 20 points (brainiest if its right and helpful)
Sunny_sXe [5.5K]

Answer:I think you just said the answer keep them in the order you have it

Explanation:so you just put the colors under the different waves

6 0
3 years ago
Read 2 more answers
Japanese honeysuckle is found in the United States. It outcompetes other plants by blooming early and dying off late. This is an
Dominik [7]

Answer:

nonnative species

Explanation:

just learned about it on Edge

6 0
3 years ago
It is necessary to digest the food we eat in order to give us the energy and nutrients needed for each of our cells to live. tru
Katyanochek1 [597]

Answer:

Explanation:

T5hdtrttiherhitirehtghireihigreidsjkgjs’trhirtfdhtgitwhisghierihghindrinkh

4 0
3 years ago
Read 2 more answers
Other questions:
  • A bird species enter the environment, but we do not know which berry color it prefers. Is the bush population more likely to sur
    12·2 answers
  • Which cell structure is correctly paired with its primary function?
    7·1 answer
  • Which of the following is an example of a density-independent factor limiting population growth? A. A forest fire that was cause
    7·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • By which process are fossil fuels formed?
    6·1 answer
  • Which of the following statements is correct?
    15·2 answers
  • 8. Ligaments are strips of tough tissue that
    9·2 answers
  • NEEEDDD HELPPPP ASAPPPPP!!!!NOO ROCKYY
    13·1 answer
  • Natural selection compared to evolution
    9·2 answers
  • What are examples of devices that use electromagnetic waves? Check all that apply.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!