1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oxana [17]
3 years ago
7

Âwhat is the term for chronic and degenerative liver disease that causes injury to the hepatocytes

Biology
1 answer:
Anon25 [30]3 years ago
3 0

The answer is cirrhosis. Cirrhosis builds up when scar tissue changes normal, healthy tissue in your liver<span>. It happens after the healthy cells are damaged over a long period of time. </span><span>This is a late stage of scarring (fibrosis) of the liver caused by many forms of liver diseases and conditions, such as hepatitis and chronic alcoholism. The liver performs a few essential roles, like cleaning your blood, detoxifying harmful substances in your body, and making vital nutrients.</span>

You might be interested in
Please help me!!!!?????? 15 points??
NemiM [27]
I think it is erosion (2) because erosion removes soil, rock, and dissolved material.
7 0
2 years ago
Read 2 more answers
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
When the total lunar eclipse occurs what are the relative positions of the sun earth and moon
Dennis_Churaev [7]

Answer:

A lunar eclipse occurs when the Moon passes directly behind the Earth into its umbra (shadow). This can occur only when the sun, Earth and moon are aligned (in "syzygy") exactly, or very closely so, with the Earth in the middle.

Explanation:

3 0
3 years ago
Read 2 more answers
Why does the moon have a effect on the sea? <br><br>will give BRAINLIEST and a thank you!​
Wewaii [24]

Answer:

The Moon's gravitational pull generates something called the tidal force. The tidal force causes Earth—and its water—to bulge out on the side closest to the Moon and the side farthest from the Moon. These bulges of water are high tides. ... High tides and low tides are caused by the Moon give me brainliest

6 0
2 years ago
Read 2 more answers
Which organelle is most prominent when looking at cheek cells under the microscope?
SpyIntel [72]
<span>Nucleus. Would be your answer</span>
8 0
3 years ago
Other questions:
  • The Florida panther faced a grim outlook, nearing extinction. Although still endangered, they are flourishing more than they wer
    12·1 answer
  • Refer to Fig. 6.4.1 and 6.5.2 for this and the next two questions. The mutation occurs in the DNA, but questions refer to result
    14·1 answer
  • Which of the following most likely happpens when a thermal energy is removed from a chemical reaction?
    12·1 answer
  • Explain how the Ocracoke ponies arrived to the island
    8·1 answer
  • Why are scientists concerned about the loss of species as a result of human activities? Why would the extinction of other specie
    12·1 answer
  • A new organism is discovered at the bottom of the ocean. A scientist is determining the composition of elements found in the tis
    15·1 answer
  • What functions do the rotifer's cilia perform?
    9·1 answer
  • Yall please help quickly!! This would mean alot (: I hope you have a good day and a great year!!
    6·1 answer
  • HELP <br><br> Why is sea temperature important?
    15·2 answers
  • On Which ends is the phosphate group on a nucleotide
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!