Answer:
Both are correct
Explanation:
Not all are flowers in the path of engine progress and development. There is a phenomenon that haunts technicians since the beginning of engine development and, it seems, will always be present in the lives of those who work with the engines, this phenomenon is called abnormal combustion, also known as spark knock, ping, and detonation.
During abnormal combustion the increase in temperature and pressure within the combustion chamber which can cause serious engine damage.
Answer:
There are the physical and chemical properties of an acid .
Both are in the image
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
Human sex cells are produced by a two-part cell division process called meiosis.
Explanation:
Through a sequence of steps, the replicated genetic material in a parent cell is distributed among four daughter cells. Meiosis produces gametes with one-half the number of chromosomes as the parent cell