All categories

3 years ago

What is the difference between microscopic and macroscopic ecosystems?

Biology

1 answer:

horsena [70]3 years ago

7 0

Answer:

Microscopic ecosystems consist of the organisms that are microscopic in nature or that which cannot be seen by naked eyes. They are mostly found in soil oceans and some are even living in association with plant and animals.

Macroscopic ecosystem consist of the organisms that can be observed with naked eyes.

They are mainly of 3 types:

Terrestrial
Aquatic
Aerial.

You might be interested in

Technician A says that spark knock, ping, and detonation are different names for abnormal combustion. Technician B says that any

V125BC [204]

Answer:

Both are correct

Explanation:

Not all are flowers in the path of engine progress and development. There is a phenomenon that haunts technicians since the beginning of engine development and, it seems, will always be present in the lives of those who work with the engines, this phenomenon is called abnormal combustion, also known as spark knock, ping, and detonation.

During abnormal combustion the increase in temperature and pressure within the combustion chamber which can cause serious engine damage.

8 0

3 years ago

The cytoplasmic extensions that, together with the cell body, provide the main receptive surfaces for neurons are the:

BartSMP [9]

I’m pretty sure it’s dendrites
:)

4 0

2 years ago

Please help me, I beg you Describe some properties of acids?

julia-pushkina [17]

Answer:

There are the physical and chemical properties of an acid .

Both are in the image

7 0

2 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago

What type of cells, sex cells or somatic cells ,are produced by this process

pogonyaev

Answer:

Human sex cells are produced by a two-part cell division process called meiosis.

Explanation:

Through a sequence of steps, the replicated genetic material in a parent cell is distributed among four daughter cells. Meiosis produces gametes with one-half the number of chromosomes as the parent cell

3 0

2 years ago