1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sattari [20]
3 years ago
9

What structures do microalgae elodea maple leaf and root hair have in common

Biology
1 answer:
OLga [1]3 years ago
3 0

Answer:

They have a nucleus, vacuole, cell wall and membrane.

Explanation:

microalgae elodea maple leaf and root hair are eukaryoti organisms and they have nucleus, cell wall and membrane in common and these structures perform different functions.

Nucleus is a membrane bound organelles that contain the DNA or genetic material . It is majorly found in eukaryotic organisms.

Vacuole is a membrane bound organelles that function in digestion, ingestion, excretion of waste and storage.

Cell wall is a structure that give shape, support and protection to cells.

Membrane is a structure that separate the internal of the cell from it outside environment and it give protection to the cell..

You might be interested in
Name the three parts of the brain.
Ksenya-84 [330]

Cerebellum

brain stem

Frontal lobe

8 0
3 years ago
Read 2 more answers
Non-living things, such as a car, often show characteristics similar to those of living organisms.
Alex

Answer:

Living and car both move, both release energy, both needs energy to move and both gets damages in accidents.

6 0
3 years ago
In which of these is osmosis occurring
lakkis [162]

Answer:

1.Plant absorbing water from the soil.

Explanation:

Osmomsis occurs by the movement of a water from a region of higher concentration of water molecules to a region of lower concentration of water molecules, through a semi permeable membrane,

<em><u>OR</u></em>

It occurs as a result of movement of substance molecules from a region of lower concentration to a region of Higher concentration of the substance.

<em><u>Note</u></em><em><u>:</u></em> The higher the concentration of the substance molecules,the lower the concentration of water molecules.

4 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
In chickens, comb shape is determined by genes at two loci (R, r and P, p). A walnut comb is produced when at least one dominant
slega [8]

Answer:

1:1:1:1 walnut comb

Explanation:

If a cross is made between a female who is RRpp (rose comb) and a male who is rrPP (pea comb)  then:

P: RRpp  x  rrPP

F1: RrPp RrPp RrPp RrPp

This means that all of the offspring in F1 generation will have heterozygous genotype (at both loci). Since it contains both dominant alleles, the phenotype is walnut comb.

4 0
3 years ago
Other questions:
  • What would be an example of ribosomes in a body
    11·1 answer
  • Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identif
    6·2 answers
  • True or False? Bacterial vaginosis is similar to syphilis in that it is caused by a single organism and is usually a serious inf
    6·1 answer
  • 1. Why is Earth an example of a system?
    5·1 answer
  • Why is the SA node called the pacemaker of the heart?
    7·1 answer
  • A student is useing a terrarium like the one shown here to study the cycling of oxygen which observation would be the best evide
    11·2 answers
  • One danger of excessive nitrogen levels in water is BLANK.
    15·1 answer
  • Describe the steps that your body takes when building immunity.
    15·1 answer
  • 2. Discuss the location of temperate Evergreen forests​
    12·1 answer
  • Without the natural filtration system of a wetland, money would most likely be spent on
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!