The answer is B) prime meridian
It is the opposite of the equator. If you need more of and explanation please just ask.
Science can be used to address societal issues and to inform policies. Hope I Helped :)
The answer is <span>hy<span>pothalamus.</span></span>
<span>The hy<span>pothalamus <span>regulates the </span></span></span><span>sympathetic nervous system, part of </span><span> autonomic nervous system, </span><span>associated with fight-or-flight </span><span>responses.
During stress situations the sympathetic nervous system is more activated, causing a response of either run or fight. Because of that, the body needs to be prepared and there will be elevated blood pressure (the blood is going more to the skeletal muscle, heart,etc), dilated pupils (for better peripheral vision) and increased respiration. </span>
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
D). Asexually through binary fission
have an amzinging day!
