1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
noname [10]
3 years ago
15

Which piece of fossil evidence would suggest the earth’s plates are moving?

Biology
1 answer:
kirill [66]3 years ago
4 0

Answer:

  • The evidence for continental drift included the fit of the continents; the distribution of ancient fossils, rocks, and mountain ranges; and the locations of ancient climatic zones.
You might be interested in
A plant is moved from direct sunlight and placed into complete darkness.
aivan3 [116]

this would cause limited growth of the plant

a plant needs good soil, water, carbon dioxide and sunlight to be healthy

hope that helped

4 0
3 years ago
Mass wasting occurs when ____
kykrilka [37]
Soil, sand, and Rock move downslope typically
3 0
3 years ago
Read 2 more answers
What do flowers and runners have in common?
Arisa [49]
They are both plants, also reproduction, and pollen, i think
4 0
4 years ago
Read 2 more answers
What did Mendels crosse pollination of pea plants prove?
AveGali [126]
C. Pea plants can have yellow seeds or green seeds
4 0
3 years ago
Oxygen has an atomic number of 8. The n = 1 energy level has two electrons, and the n = 2 energy level has six electrons. Oxygen
natita [175]
<span>Valence is defined as number of electrons that are present in the outermost orbital. Oxygen is in the 16th column of the periodic table and the total number of valance electrons is determined by units place digit of the column position which is 6 for oxygen. The outermost orbital is the high energy level and there are two in that orbit. So the valance is +2.</span>
4 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How were Lamarck’s and Darwin’s ideas most similar?PLEASEEEE ANSWERRRRR ASSSAAAPPPPPPPPPPPPPPPP
    7·2 answers
  • 10. During photosynthesis, plants need a constant supply of _
    12·1 answer
  • Suppose that an error in transcription alters the formation of a single trna molecule in a cell. the altered trna still attaches
    15·1 answer
  • If the percent concentration is equal both inside and outside a cell, water does not move into or out of the cell?
    13·1 answer
  • Based on the procedures and data, which of these is the MOST appropriate
    14·1 answer
  • A group of students investigated the effect of soaking small onion bulbs in different concentrations
    7·2 answers
  • Important test and i have limited time so please hurry &lt;3
    8·2 answers
  • How many weeds are on the noxious weed list?
    12·1 answer
  • Many farmers are worried about the decreasing genetic diversity of plants associated with generations of artificial selection an
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!