1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitry_Shevchenko [17]
3 years ago
15

to make 2 batches of nut nars, jayda needs to use 4 eggs how many eggs used in each batch of nut bars

Mathematics
1 answer:
muminat3 years ago
4 0
To solve this problem, we need to set up a proportion.

2 batches of nut bars/ 4 eggs = 1 batch of nut bars / x eggs.

To solve this proportion, we use cross products, or multiplying the numerator of one number by the denominator of the other and setting them equal to one another.

(4 eggs) (1 batch) = (2 batches) (x eggs)

4= 2x

2=x

Therefore, 2 eggs are used in each batch of nut bars.
You might be interested in
A box of cereal was marked down $0.72. if it usually costs 3.60 what is the discount of percent
hram777 [196]
The answer would be a 5% discount.
6 0
2 years ago
Anyone help with this math question please dont geuss
Yanka [14]

Answer:

For each ticket sold they earned 3 dollars

Step-by-step explanation:

6 0
2 years ago
Help me please !!!!!
Nina [5.8K]
The answer is C. you can check the attached picture.

4 0
3 years ago
1.44 divided by 0.4
Valentin [98]
ANSWER:
yes


EXPLANATION
4 0
2 years ago
Read 2 more answers
20% of what number is 14
Ahat [919]
14×5=70

answer; 70 :)
4 0
3 years ago
Read 2 more answers
Other questions:
  • Can someone help? ?!?!?!????!?!
    12·1 answer
  • when you start from a given set of rules and conditions and determine what must be true, you are using ____ reasoning.
    6·2 answers
  • Dana can jump a rope 264 times in 4 minutes. How many jumps can Dana make in one minute?
    8·2 answers
  • Molly works at an apple orchard.She picked 1,078 apples test weekend and put them into bags that hold 12 apples each.How many ba
    7·1 answer
  • Please help answer this❤️
    10·2 answers
  • What is a sample space?
    15·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • How many km are equal to 5,995 dm?
    15·2 answers
  • Is linear equations algebra or pre-algebra??? And is "Collage and career ready math" higher than regular 8th grade math????
    6·1 answer
  • 2^4n × 2^ 2n = 512<br> What is the value of n.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!