1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLEGan [10]
3 years ago
5

On topographic maps, how does the spacing of contour lines relate to continental and ocean-floor topography? A. For both contine

ntal and ocean-floor topography, gentler slopes are represented by widely spaced lines while steeper slopes are represented by closely spaced lines. B. Only closely spaced lines are used to represent continental topography, while only widely spaced lines are used to represent ocean-floor topography. C. For both continental and ocean-floor topography, steeper slopes are represented by widely spaced lines while gentler slopes are represented by closely spaced lines. D. Only widely spaced lines are used to represent continental topography, while only closely spaced lines are used to represent ocean-floor topography.
Biology
1 answer:
Trava [24]3 years ago
4 0

For both continental and ocean-floor topography, gentler slopes are represented by widely spaced lines while steeper slopes are represented by closely spaced lines.

Explanation:

The contour lines are one of the main, and one of the most used methods on the maps for representing the topography. Basically, the contour lines are closed lines that connect dots on the same elevation. It may sound very simple, but they do provide good insight into the topography, especially if the reader of the map knows how to interpret them well.

The contour lines are used both for continental and ocean-floor topography. The rules are the same for both, including the representation of the slopes. When a slope is gentler, the contour lines are more widely spaced. When a slope is steeper, the contour lines are much more closely spaced.

Some elements of the contour lines or that go with them to give better representation are:

  • black dots (representing a top)
  • thicker lines (every fifth, so that the counting is faster and easier)
  • small lines with given direction (representing cliffs or highly steep slopes)
  • numbers (providing information about elevation)

Learn more about contour lines brainly.com/question/1972242

#learnwithBrainly

You might be interested in
Why are chloroplasts absent in epidermal cells ?
const2013 [10]
<em>the function of epidermis is to protect the leaf
make it air tight 
prevent water loss as it is waxy
also it is transparent and allows all light to enter...
   chloroplast is required for carrying out process of photosynthesis...
    as epidermis is not specialized to carry out photosynthesis... so it does not have any chloroplast...</em>
6 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What are the constants for the above scenario?
Serjik [45]

Answer:

what scenario, nothing is there

8 0
2 years ago
A wolf attacks a porcupine and gets stung with quills. The wolf no longer attacks porcupines. What type of behavior does the wol
Anika [276]
I think anger and fear 
7 0
3 years ago
Read 2 more answers
Area of the brain linked to pleasure is located in the brain structure known as the:
iris [78.8K]
For the answer to the question above, it is t<span>he </span>cerebellum, it<span> plays an important role in balance, motor control, but is also involved in some cognitive functions such as attention, language, emotional functions (such as regulating fear and pleasure responses) and in the processing of procedural memories.
I hope my answer helped you.</span>
3 0
2 years ago
Other questions:
  • __________ is the study of body motions as a form of communication.
    12·2 answers
  • The classification of species is what
    12·1 answer
  • Explain overproduction
    8·2 answers
  • Will give brainliest:
    7·1 answer
  • What change in a gene pool is occurring
    9·1 answer
  • The populations living on a rough, steep mountain would have a higher rate of speciation than this living in a large, open grass
    14·1 answer
  • Describe what the layers of the earth are made of and their approximate temperature.
    8·1 answer
  • Yo can someone help me out
    6·2 answers
  • 1.What is a double diet? What do you think the advantages are, if any, of having a double diet
    10·1 answer
  • WHAT MIGHT HAPPEN IF<br> ALL THE HERBIVORES IN<br> A FOOD WEB<br> DISAPPEAR?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!