1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastasy [175]
3 years ago
13

What characteristic best distinguishes runoff and infiltration

Biology
1 answer:
Nikolay [14]3 years ago
8 0

Runoff describes water movement and infiltration describes water storage.

You might be interested in
Wich make the pear troublesome?<br>A. Sclerenchyma<br>B. Collenchyma<br>C. Parenchyme​
ale4655 [162]

Answer:

sclerenchyma is the answer

3 0
3 years ago
Read 2 more answers
The movement of an charged ion across a membrane can be altered due to what factors ?
valentinak56 [21]

Answer:

HOW ARE YOU. I NEED THIS ANSWER AND POINTS....

Compare these two cells. Plant and animal and identify the difference and similarities.

WITH EXPLANATION

Explanation:

Compare these two cells. Plant and animal and identify the difference and similarities.

WITH EXPLANATION

7 0
3 years ago
When atoms gain or lose electrons to become charged and then are attracted to each other like a magnet, it is called a(n) _____
Stella [2.4K]
That would be a covalent bond. Hope this helps!
8 0
3 years ago
What is a turgid cell
Lena [83]

Answer:

turgid refers to cells or tissues that are swollen from water uptake. Many cell types in many different organisms can become turgid due to water uptake. Some cells will lyse, or split open if they become too turgid.

6 0
3 years ago
Read 2 more answers
What is a good hypothesis for this question do you think that the marketing to children is a social problem? What are some varia
Kitty [74]

I would say it is unethical becuase many young children can't tell when they are being marketed to and you should focus marketing to the kids parents.

3 0
3 years ago
Other questions:
  • One side of your face is identical to the other side. You are _____. radially symmetrical asymmetrical bilaterally symmetrical
    7·2 answers
  • A weather station predicts that warm, humid air will pass over much cooler land during the early morning hours. Which precaution
    12·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Distance of 45km at speed of 15 km/h , how long did their journey take​
    6·1 answer
  • Which is the largest? 1. Cells 2. Grain of rice 3. Molecule. 4. DNA
    13·2 answers
  • Lucas is carrying his rock collection into class. He carries 30 pounds of rare rocks 15 feet into Classroom 6. It takes him 3 mi
    8·1 answer
  • Organisms in the clade Ecdysozoa undergo ecdysis to shed what structure?
    14·1 answer
  • The Divide-a-Lot chemical _____ the egg cell so cell division can begin. N​
    5·1 answer
  • 5. If Laura rides her bicycle down a straight road for 500 m, then turns around and rides back to where she
    10·1 answer
  • In humans, the inheritance of what is best explained as being codominant
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!