1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xxTIMURxx [149]
3 years ago
6

Q1: How are all of the five biogeochemical cycles similar?

Biology
1 answer:
Sonja [21]3 years ago
6 0

Answer:

One thing that ALL biogeochemical cycles have in common is. they involve the movement of specific chemicals between living and non-living things. they involve the changing of carbon into carbon dioxide. they are pathways for elements that get passed between only non-living things

Explanation:

You might be interested in
Oftentimes, when a plant dies, the caretaker may
aalyn [17]

Answer:

233

Explanation:

772

4 0
3 years ago
How do eukaryotic plant and animal cells differ from one another?
Ber [7]

Answer:

The eukaryotic plant animal cells are differ having some cell organelles in it.

Explanation:

The first difference is the cell wall, which is present in all eukaryotic plants. It gives shape and rigidity to the plants. But all the animal cell the outer covering is cell membrane. They lack cell wall.

All the plant cell have chlorophyll pigment. It helps them to photosynthesis. In animal cell, chlorophyll molecule are absent. So they depend on plants for their food.

The eukaryotic plant cell more space is occupied by the vacuoles. It stores food and water for the plants. However, animal cells have no vacuole or if present, it is very small in size.

All animal cells have lysosomes, which help in digestion of various materials in the cell. Plants does not contain lysosomes.

Besides this organelles all other structure of plant and animals are similar. They both have nucleus, DNA, cytoplasm, mitochondria, etc.

4 0
3 years ago
Which of the following is a testable hypotheses
tamaranim1 [39]

Answer:

B.

Explanation:

8 0
3 years ago
Read 2 more answers
Examine the image of the relatedness of vertebrates represented in this phylogenetic tree. Select all the statements that are su
sveticcg [70]

Answer: Gray whales are the common ancestor of the Blue and Humpback whales.

Ancestors of Blue whale include: Gray?

3 0
3 years ago
Read 2 more answers
How do sensory receptors send messages to the brain?
dezoksy [38]

Answer:

4

Explanation:

How do (sensory) receptors send messages to the brain?

Via (sensory) neurons

8 0
3 years ago
Other questions:
  • The form of energy most responsible for producing sunlight is A) heat energy. B) nuclear energy. C) chemical energy. D) mechanic
    10·2 answers
  • Which types of polygons are the faces of a dodecahedron?
    13·2 answers
  • Humanity’s ecological footprint is already overburdening the Earth, but, approximately 1/3 of the world population lives on less
    11·1 answer
  • Even though RSV infection in infants is common, a vaccine does not currently exist. Imagine you are designing a recombinant vacc
    14·1 answer
  • What did the structure of DNA’s double helix suggest about DNA’s properties? Select all that apply.
    10·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Nuclear energy is a non-renewable energy source.<br> True<br> False
    11·2 answers
  • What do you think should be the maid focus of scientific research to help curb this pandemic?
    14·2 answers
  • Which sentence best describes evolution?
    9·2 answers
  • If two organisms of different species share more similar DNA sequences with each other than with other species, we can conclude
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!