1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Llana [10]
3 years ago
15

propose a hypothesis for the evolution of ife on earth from single-celled organisms to multicellular organisms. can you suggest

the most significant step in the evolution of multicellularity? please explain
Biology
1 answer:
Anna71 [15]3 years ago
3 0

Explanation:

according to my hypothesis evolution of life from single celled organisms to multi cellular organism is that in order to for a single celled organism to adapt and survive it needs to combine or fuse biologically or through evolutionary adaptation to another or more single celled organisms

You might be interested in
What happens to contraction of a muscle cell if some of the Ca2+ that was released during a contraction is still in the cytoplas
Kazeer [188]
<h2>Muscle contraction in cytoplasm </h2>

Explanation:

  • Calcium stays in the sarcoplasmic reticulum until discharged by an improvement. Calcium at that point ties to troponin, causing the troponin to change shape and expel the tropomyosin from the coupling destinations. Cross-connect stick proceeds until the calcium particles and ATP are never again accessible.
  • ATP is basic to get ready myosin for official and to "revive" the myosin.
  • When the actin-restricting destinations are revealed, the high-vitality myosin head overcomes any issues, framing a cross-connect. When myosin ties to the actin, the Pi is discharged, and the myosin experiences a conformational change to a lower vitality state. As myosin consumes the vitality, it travels through the "power stroke," pulling the actin fiber toward the M-line.

4 0
2 years ago
Some types of pollution are hard to
Zanzabum
The answer is the first one ( True )
3 0
2 years ago
Name two actions<br> that you could take to reduce elephant poaching.
AURORKA [14]

Answer:

increase protection and communal conservancies

Explanation:

increase protection this one is a fairly basic solution, there are many different ways of implementing it. Some park protection agencies in Africa use drones to keep watch at night, while others have sought out military tactics in order to stop black market poachers. Communal conservancies despite global trends, Namibia has done something extraordinary. Between the years of 2002 and 2013, the elephant population has grown from 9,600 to 16,000. The government of Namibia has policies in action where local communities can establish wildlife tourism, and where communities can keep vast amounts of the revenue made.

8 0
2 years ago
All BUT one description applies to the structure of RNA. That is A) four nitrogenous bases. B) double-stranded molecule. C) cont
irakobra [83]
double  stranded  molecule does  not  describe the  structure  of RNA. Most  RNA  are  single  stranded  with  partial  double  stranded  regions.  RNA  has  basic   component  as  the  DNA  that  is have  four  nitrogenous  base,  contain  phosphate  group  and  have  5  carbon sugar.
6 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
2 years ago
Other questions:
  • Which of the following is not a characteristic of natural selection?
    13·1 answer
  • 1. Do the location of landforms (mountains, trenches, and volcanoes), earthquakes, and mineral deposits have anything in common?
    6·1 answer
  • The loss of the ability of the larynx to produce normal speech sounds is called:
    14·1 answer
  • What roles do proteins play in organisms?
    9·1 answer
  • Which discovery is attributed to PhoebuA single strand of DNA helix has the code CGCTAA. Which would be the complementary code o
    7·1 answer
  • Name 3 Native American groups who sided with the French
    12·1 answer
  • Oliver can't seem to learn all the types of animals living in a desert habitat. which type of memorization strategy might you re
    6·2 answers
  • What is required in order to determine whether or not an object moves?
    14·2 answers
  • Why are house keys usually made of metal rather than glass, wood, or fabric
    15·1 answer
  • 3. what Unicellular organisms that lack nuclei. *
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!