1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Triss [41]
3 years ago
6

Which of these statements is true for restriction enzymes? each restriction enzyme is able to make a staggered cut at its recogn

ition site. a given restriction enzyme will always recognize the same dna sequence, but it will cut differently depending on the species of origin of the dna. a different restriction enzyme must be used to open the vector dna than to excise the gene sequence to be cloned. any restriction enzyme can cut any piece of dna. restriction enzymes are useful in genetic engineering when they make staggered cuts in dna?
Biology
1 answer:
irina1246 [14]3 years ago
6 0
The 1st one is correct.:) 

You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Kevin is studying predator-prey interactions. One day he notices a spider eating a cricket caught in its web. Later that day, a
s344n2d4d5 [400]

Answer:

The correct answer is option - A. 0.

Explanation:

Producers are the organism that produces on their own. They do not depend on other organisms for their nutrition and energy such as green plants. They transfer energy and nutrition.

In the given scenario there is no producer present all are consumers of different levels. Cricket is a primary consumer, a spider is a secondary consumer and bird is the third consumer in this food chain.

Thus, the correct answer is option- A. 0.

4 0
3 years ago
Examples of multiplecropping
natulia [17]
Example of multi cropping is tomatoes+onions+marigold
7 0
3 years ago
Two stores sell CDs in packages, as shown in the table below.
vova2212 [387]

Answer:

10. 50 ehaisnenhsiwolen br isiwokneb

5 0
3 years ago
Which of these processes do not occur as a part of the cell cycle in the animal cells
saw5 [17]
D i believe i’m sorry if this is not correct if not try c
8 0
3 years ago
Read 2 more answers
Other questions:
  • 11) What is the important outcome of meiosis I?
    12·1 answer
  • How are dna and mrna alike
    5·2 answers
  • Which is the largest gland in the body?
    9·2 answers
  • Describe what all living things must have for the next generation to be created. It is NOT
    6·1 answer
  • Lunar phases summary 2-4 sentences
    14·1 answer
  • What are the genotypes of the parents?<br><br> Please help asap I’m on a time limit
    15·1 answer
  • I’m very confused on this question so i rlly need help asap
    13·1 answer
  • Which of the following statements below are TRUE about Keystone Species? Pick all that are correct
    14·1 answer
  • An individual's conscious decision to urinate is due to altering nerve signals relayed from the cerebral cortex through the spin
    5·1 answer
  • Someone plz help me plzz :(
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!