1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liq [111]
3 years ago
8

The difference in lipid and protein composition between the membranes of the endomembrane system is largely determined by the __

___. The difference in lipid and protein composition between the membranes of the endomembrane system is largely determined by the _____. function of the Golgi apparatus in sorting and directing membrane components transportation of membrane lipids among the membranes of the endomembrane system by small membrane vesicles modification of the membrane components once they reach their final destination interconnection of most intracellular membranes to the nuclear envelope synthesis of different lipids and proteins in each of the organelles of the endomembrane system
Biology
2 answers:
lyudmila [28]3 years ago
5 0

Answer:

Golgi apparatus in sorting and directing membrane components

Explanation:

The Golgi apparatus has sacs called cisternae. It is present in the cytoplasm of eukaryotic organisms.

It helps in the manufacture of an organelle called lysosome which acts as a digestive enzyme.

The Golgi apparatus helps in sorting out proteins for secretion.

It also helps in the transportation of lipids around the cell.

11Alexandr11 [23.1K]3 years ago
4 0

Answer:

function of the Golgi apparatus in sorting and directing membrane components.

Explanation:

Endomembranous system is the name given to a set of different membranes that are inserted in the cytoplasm of eukaryotic cells. The main function of this system is to promote compartments within the cell to group organelles according to the functions they perform. We can say that the cell is a large company and the membranous system is responsible for separating each department within the company.

The organelles that make up this system are: the nuclear envelope, endoplasmic reticulum, the Golgi complex, lysosomes, vacuoles, vesicles and the cell membrane. The golgi complex, in turn, has a primary function in the functioning of this system. This is because the difference in lipid and protein composition between the membranes of the endomembranous system is largely determined by the role of the Golgi apparatus in screening and direction of the membrane components.

You might be interested in
Describe two things the prairie dogs need to live that they obtain from their habitat
musickatia [10]

Answer:

A Sunlight enables this plant to make its own food. Soil Soil is a mixture of rock fragments, nutrients, air, water, and the decaying remains of living things.

Explanation:

4 0
3 years ago
What would happen if the Earth had just 5% more oxygen in the atmosphere​
7nadin3 [17]

if the Earth had 5% more oxygen in the atmosphere Global warming will happen.

7 0
3 years ago
Spontaneous mutations occur most commonly as a result of _________________________ .
Ray Of Light [21]
Errors during duplication, errors during recombination, the movement of genetic elements, and dna damage
4 0
1 year ago
Which describes John datiton observations of elements in any given compound
dmitriy555 [2]

Atoms of different elements always combine in the same way.

John Dalton noted that if the components are added to one exacerbated, the share of their masses will dependably be the same. Dalton's been an English scholar. The component mass of that mix is measured by the confirmation of the presence of molecules assembled by John Dalton.

3 0
3 years ago
.<br> the study of the body's parts and how they are put together
Sergeu [11.5K]

Answer: organ system

Explanation:

3 0
3 years ago
Other questions:
  • Cyanide is a poison that inhibits the electron transport chain by creating a strong and stable bond with Fe–Cu center in cytochr
    12·1 answer
  • which part of the central nervous system is used to used to serve as the main communication link between the body and the brain?
    12·2 answers
  • 1. (1-4) What are the horizontal and vertical lines on a map called?
    14·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Chad drew a diagram to compare animal cells and bacterial cells.
    13·2 answers
  • Which group within an ecosystem contains the most energy
    13·2 answers
  • What main idea about the nature of the cell did historical scientists disagree on?
    5·1 answer
  • Measuring Populations (brainliest)
    12·2 answers
  • Why do vertebrates have vertebrae instead of just having one long backbone?
    11·1 answer
  • 2
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!