1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetoff [14.1K]
3 years ago
14

Given the function f(x) = x2 and k = 3, which of the following represents the graph becoming more narrow? A. f(x)+k

Mathematics
2 answers:
balandron [24]3 years ago
6 0
<h2>Answer:</h2>

The following which represents the graph becoming more narrow is:

                    B.    kf(x)

<h2>Step-by-step explanation:</h2>

We are given a parent function f(x) as:

          f(x)=x^2

and k=3

Now, we know that the transformation of the type:

          f(x)+k

shifts the graph of the function k units upward while there is no change in the shape of graph.

Similarly the transformation f(x+k) and f(x-k) shifts the graph of the original function k units to the left and  k units to the right but odes not change the shape of the function.

            Hence, the answer is:

                      B.    kf(x)

   Since, the  transformation is a vertical compression and the graph becomes more narrow.

Neko [114]3 years ago
4 0
<span>The only type of transformation that can make a graph more narrow/wide is a scaling transformation. A scaling transformation involves a multiple factor. The answer to your question is B. </span>I hope that this is the answer that you were looking for and it has helped you.
You might be interested in
The table shows the amounts y (in tons) of waste left in a landfill after x months of waste relocation. Use the table to complet
Irina-Kira [14]

Answer: it would take 1 year

Step-by-step explanation: scince it took 1/2 a year to get rid of half the waste it would take another 1/2 a year to get rid of the rest to it would take 1 year to get rid of all of the waste

4 0
3 years ago
Solve the system of equations 4x + 8y = 4 and —2x – 7y = -11 by combining<br> the equations.
masya89 [10]

Answer:the answer is six

Step-by-step explanation:

6 0
3 years ago
Kim has worked in the tech industry for some time and would like to start consulting. In opening her new business, she will need
zimovet [89]
Cost of 3 laptops
3×546.78
=1,640.34
Cost of 2 desktop computer
2×1,255.99
=2,511.98
Cost of fax machine
125.99
Total cost
(1,640.34+2,511.98+125.99)
=4,278.31
So Kim will need an additional 778.31 to start her business
4,278.31−3,500
=778.31
7 0
3 years ago
Read 2 more answers
Find the area. Round to the nearest tenth.<br>6 ft<br>3 ft<br>12.16 ft<br>9.16 ft<br>​
bagirrra123 [75]

Answer:

100.5 ft^2

Step-by-step explanation:

First find the area of the rectangle

A = l*w

A = 12.16 * 6

A =72.96 ft^2

Then find the area of the triangle

A = 1/2 bh

The base is 12 ft - 6ft = 6ft

The height is 9.16 ft

A = 1/2 ( 9.16) * 6

A = 27.48 ft^2

Add them together

27.48+72.96

100.44 ft^2

Round to the nearest tenth

100.5 ft^2

7 0
3 years ago
Read 2 more answers
The inequality x + 2y ≥ 3 is satisfied by point (1, 1).<br> True<br> False
andre [41]
In the given statement above, in this case, the answer would be TRUE. It is true that the  inequality x + 2y ≥ 3 is satisfied by point (1, 1). In order to prove this, we just have to plug in the values. 1 + 2(1) <span> ≥ 3 
So the result is 1 + 2 </span> ≥ 3. 3 <span> ≥ 3, which makes it true, because it states that it is "more than or equal to", therefore, our answer is true. Hope this answer helps.</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • The radius of Earth is 6,378.1 km, which is 3,938.1 km greater than the radius of Mercury. Find the radius of Mercury.
    15·1 answer
  • Graph a line Slope of -5 and contains the point -3,-4
    10·1 answer
  • Jeff had $20. He spent
    9·1 answer
  • The ratio of men to women to children at a concert was 3:5:2. If there were 360 more adults than children, how many people were
    9·1 answer
  • 1) x+3 - 5x + 7 + 4y​
    10·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Please help will mark brainly
    14·1 answer
  • Linear e
    14·1 answer
  • The size of a computer class is limited to fifteen people. If three seats are still available, to what percent of its capacity i
    7·1 answer
  • Solve the equation -8 = -3 - 6 cube root x^2
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!