The answer
is
<span> <span>tcgccctactcgcgtacaccgcgtattgac3’
3’
</span></span>
<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>
<span>This is keeping
in mind that purines (adenine and guanine) match with pyrimidines (cytosine and
thymine). Adenine
specifically pairs with Thyamine while Cytosine pairs
with Guanine. Replication means the DNA is being duplicated therefore, the main
enzyme is DNA polymerase. Were it transcription
(involving transcription to RNA), adenines would match with Uracil </span>
Answer:
follow me and please mark as brainliest answer
Explanation:
wolfs play a key role in keeping ecosystem healthy the Caracesess of their prey also help redistribute nutrients and provide food for other wildlife species like, grizzly bears and scavengers..
