Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Gypsy moths are consumers because they consume flower nectar and juice from rotten fruits.
Answer: papillary muscle
Chordae tendinae is a connective tissue that used to prevent the heart valve to be flapped away. It like a string that connected into the valve and makes it look like a kite. Papillary muscle is the part that anchoring it to the heart wall.
Genetic engineering is a big part of agriculture. that would be your answer
Answer:
As the white light moves through the two faces of the prism, the different colors bend different amounts and in doing so spread out into a rainbow. In a rainbow, raindrops in the air act as tiny prisms. Light enters the raindrop, reflects off of the side of the drop and exits.
