No I believe that’s False
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
Explanation:
Causes for Disruptions in the Food Web
Overpopulation.
Water pollution.
Acid rain.
Climate change.
Air pollution.
Illegal hunting.
Soil pollution.
Illegal dumping.
Answer: can i pls get brainliest
i believe its river
Explanation:
A watershed is land that contributes water to a stream, river, lake, pond, wetland or other body of water. The boundary that separates one watershed from another, causing falling rain or melting snow or spring water to flow downhill in one direction or the other, is known as a “watershed divide”.
Ribosomes- Organelles that help in the synthesis of <span>proteins.</span>