3 years ago

All are eating disorders except: question 2 options: vegetarianism binge eating anorexia nervosa bulimia

1 answer:

8 0

Vegetarianism. It just means you eat vegetable based foods. It is like Vegans, but Vegans don't even consume animal bi-products like eggs, milk, cheese, dairy etc. All others are eating disorders.

You might be interested in

If a patient has br with brp, when should the patient be allowed out of bed?

Dovator [93]

Only when given OOB out of bed

5 0

3 years ago

What does the shape of the enzyme have to do with how well the enzyme works?

konstantin123 [22]

A lot of the enzymes activity is told by told by it's shape

3 0

4 years ago

Read 2 more answers

If you get something in your eyes in the lab, what is the most important thing to do? Put on your goggles. Protect your clothing

Shalnov [3]

Use the eye wash station immediately! Hope this helped!

-Twixx

5 0

4 years ago

Read 2 more answers

5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.

dusya [7]

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'

8 0

3 years ago

How the disease Diabetes challenges our body’s ability to maintain homeostasis.

Kay [80]

Answer:

diabetes is bad diseases that causes you to eat less sugar

3 0

3 years ago