1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brilliant_brown [7]
2 years ago
8

How did the reintroduction of wolves into Yellowstone park return the stability to the Yellowstone ecosystem

Biology
1 answer:
Anton [14]2 years ago
6 0
They are the overpopulated prey in Yellowstone
You might be interested in
Humans use many chemical substances for farming that consequently affect biodiversity. These compounds, which are rich in nitrog
posledela

Answer:

algal growth due to eutrophication

Explaination:

Eutrophication is where these nutrient rich compounds mix with nearby water sources and promote the growth of large amounts of algae. Algae go through respiration and take up the dissolved O2 in water which causes these areas to experience low O2 levels. Everything needs O2 to survive thus nearby organisms and plants die out creating dead zones.

7 0
3 years ago
Read 2 more answers
 In which of the following situations is salinity highest? 
alexdok [17]
C) evaporation exceeds precipitation 

7 0
3 years ago
Plz help me I am timed
creativ13 [48]

Answer:

geyser

Explanation:

7 0
2 years ago
Other molecules that make up the cells are
Shalnov [3]
Cells are composed of water, inorganic ions, and carbon-containing (organic) molecules. Water is the most abundant molecule in cells, accounting for 70% or more of total cell mass. Consequently, the interactions between water and the other constituents of cells are of central importance in biological chemistry.
8 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Other questions:
  • What is the atmospheric layer with the lowest density??
    11·1 answer
  • Which term refers to an organism that eats prey?
    15·1 answer
  • What piece of evidence would cause scientists to decide that the cell theory would need to be revised?
    5·1 answer
  • 8.
    6·2 answers
  • I NEED HELP PLEASE
    7·1 answer
  • During which lunar phase is the moon’s far side entirely lit?
    11·1 answer
  • A guess about what will happen,not based on any previous observations or knowledge.
    7·1 answer
  • How might the migration of individuals in or out of the habitat affect the frequency of each allele in this population?
    15·1 answer
  • Please help!
    6·1 answer
  • I need help with both of these questions
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!