1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vekshin1
3 years ago
5

Plants need carbom dioxide in order to survie. plants get this gas from ______, which is something all organisms need

Biology
1 answer:
Leviafan [203]3 years ago
6 0

Answer:

Photosynthesis

Explanation:

You might be interested in
In what ways would understanding the body position,directions, and planes assist you with tasks related to the integumentary, sk
ivann1987 [24]
It would help you know how they all work together like how the musicular system helps the digestive system during digestion 
6 0
3 years ago
Does my crush like me?​
Nana76 [90]
Maybe bro. You should try and give it a chance most likely they’ll say yes :)
4 0
3 years ago
Read 2 more answers
Urinary retention with consistent or intermittent dribbling of urine is called a. mixed incontinence. b. overflow incontinence.
NeTakaya

Answer:

b. overflow incontinence

Explanation:

Overflow incontinence is a medical condition that is characterized by uncontrolled leakage of urine from filled urinary bladder in the absence of the urge to urinate by the affected individual.

It is a condition that is usually caused by blockage of bladder outlet or weakness in the muscle responsible for the expulsion of urine from the bladder.

The correct option is b.

5 0
3 years ago
Which complex carbohydrate contains only a-1,4-glycosidic linkages?
Andrei [34K]

Answer: Amylose

Explanation: Which complex carbohydrate contains only a-1,4-glycosidic linkages? Amylose (Amylose is formed from a-1,4-glycosidic linkages of glucose.)

5 0
3 years ago
What do we call a procedure used to test a hypothesis
julia-pushkina [17]
An experiment can be used
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which would have more epitopes a protein or a lipid?
    13·1 answer
  • Which statement correctly describe the difference between meiosis 1 and meosis 2
    7·1 answer
  • Select all that apply. For the photosynthesis process to occur, a plant needs _____. sunlight chlorophyll nitrogen carbon dioxid
    6·1 answer
  • What is always true of scientific practices a. They prove a hypothesis to be correct b. They involve steps performed in the same
    5·1 answer
  • Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome.
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What to use to build an organism
    12·1 answer
  • In a forest ecosystem, seeds are eaten by mice, which are eaten by hawks. If the population of hawks suddenly increased:
    10·1 answer
  • One function of the vacuole is the storage of water.
    9·1 answer
  • Sun-->sagebrush-->jackrabbits-->coyotes
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!