1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Advocard [28]
3 years ago
14

Which term is used to describe what causes organisms to react to their environment? A. Stimulus B. Camouflage C. Parasites D. ho

meostasis
Biology
1 answer:
Shalnov [3]3 years ago
4 0
<span>A. Stimulus is the term used to describe what causes organisms to react to their environment. Stimulus is something that can provoke organisms to respond to the world around them. For example, if you put your hand on the stove, the stove is going to be the stimulus for you to get burned and move your hand from it because it will be to hot - that is going to be your reaction to the stimulus. Camouflage is a type of hiding mechanism, parasites are organisms, and homeostasis is equilibrium in an organism. </span>
You might be interested in
The nucleoid region of a prokaryotic cell
Vladimir79 [104]

Answer:

A. contains the cell's DNA

Explanation:

Prokaryotic cells such as the bacterial cells and the cells of archaeans do not have a membrane-bound nucleus. Their genetic material DNA is present in the cytoplasm only. However, their genetic material is concentrated in a specific region inside their cells. This is called a nucleoid. Nucleoid does not have any surrounding membrane. It represents the nuclear area where the DNA of the prokaryotic cells is present.

7 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
An ecosystem engineer can cause a cascade of effects including abiotic and biotic changes.
Inessa05 [86]

Answer:

O True

Explanation:

Ecosystem engineers are able to modify the surrounding environment, either by creating new habitats or modifying/destroying existing ones to adjust them to their needs. These species can significantly alter their environments, having a large impact on the species richness as well as modifying the availability of abiotic factors (e.g., water, space, etc) of a particular area. In certain environments, ecosystem engineers can even act as keystone species. Some examples of ecosystem engineers include, among others, beavers, woodpeckers, corals, etc.

4 0
3 years ago
PLS HELP ASAP!!! I WILL NAME BRAINLIEST!!
atroni [7]

Answer:

either B or D because at the end Whilst the ultimate outcome of the lytic cycle is production of new phage progeny and death of the host bacterial cell, this is a multistep process involving precise coordination of gene transcription and physical processes.

8 0
3 years ago
BRAINLIESTTT ASAP!!!
earnstyle [38]
They have the same mass as the mass of the reactants. evidence to back this up is the law of conservation of mass


6 0
3 years ago
Read 2 more answers
Other questions:
  • A cross involving true-breeding, red snapdragons and true-breeding, white snapdragons produce all pink offspring because both ge
    11·2 answers
  • A population of bacteria is treated with an antibiotic. It is estimated that 5,000 live bacteria existed in the sample before tr
    14·2 answers
  • What are cells where the genetic material is contained in membrane-bound nuclei?
    8·1 answer
  • Comparing Viral Structures
    12·1 answer
  • What can you tell about igneous rock that is coarse grained? Apex
    12·2 answers
  • What is the simplification of 10/15​
    10·2 answers
  • The combination of dominant tree species in Eastern forests will likely change in the future. Some forest types,
    11·2 answers
  • The mammoth, which was very hairy, and the elephant, are both thought to have evolved from a scantily haired ancestor. Explain,
    7·1 answer
  • For addition and subtraction properties 1.b -7 &gt; - 9​
    7·1 answer
  • 2. When the plastic sheet is pulled down (inhalation), what happens to the pressure in the plastic bottle?​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!