1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiks02 [169]
3 years ago
5

The epicenter of an earthquake is located in a sandy desert region. Seismic waves move outward from the epicenter. A rocky regio

n is located a few hundred miles from the desert. The particles of matter are more closely packed in rock than they are in sand. Which statement correctly describes the change in seismic waves as they move from sand to rock?
A.
The waves change from transverse to longitudinal.
B.
The waves change from longitudinal to transverse.
C.
The waves speed up.
D.
The waves slow down.
E.
The wave speed is unchanged.
Biology
2 answers:
wolverine [178]3 years ago
6 0

The answer is D.The waves slow down

nlexa [21]3 years ago
6 0

D.  

The waves slow down.

You might be interested in
How do the lipids of the cell membrane and the lipids found in butter and vegetable oil differ?
Liula [17]

Answer:

The lipids of the cell membrane and the lipids found in butter and vegetable oil differ in the number of fatty acids attached to the glycerol molecule.

5 0
3 years ago
.(choose all which
11111nata11111 [884]

Answer:

Myogenic mechanisms

Hormones

Sympathetic nervous system  

Explanation:

Myogenic mechanisms work in the arterioles that serve the glomerulus.

They cause the smooth muscle cells in the arterioles to contract and relax in response to blood pressure changes.

The sympathetic nervous system increases blood flow through the kidneys during resting conditions.

At times of stress, it decreases blood flow through the kidneys, making it more available to the rest of the body.

The hormones angiotensin and aldosterone regulate blood volume by controlling retention of Na⁺ and water.

C is wrong. The parasympathetic nervous system mainly controls visceral organs such as glands.

6 0
3 years ago
What arrow under the words the words Arctic Air indicates what?
katrin2010 [14]
Artic air is the answer to this
7 0
3 years ago
WIILL BE MARKED BRAINLIEST!!!
Phantasy [73]

Answer: Lungs

Explanation:

Examples of endocrine organs include the pancreas, which produces the hormones insulin and glucagon to regulate blood-glucose levels, the adrenal glands, which produce hormones such as epinephrine and norepinephrine that regulate responses to stress, and the thyroid gland, which produces thyroid hormones that regulate to the Lungs.

7 0
3 years ago
Read 2 more answers
Which best describes a plasmid?​
DIA [1.3K]

Answer:

a system whereby the government undertakes to protect the health and well-being of its citizens, especially those in financial or social need, by means of grants, pensions, and other benefits. The foundations for the modern welfare state in the US were laid by the New Deal programs of President Franklin D. Roosevelt.

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • This is a chemical bond that forms between the carboxyl group of one amino acid and the amino group of the adjacent amino acid d
    13·2 answers
  • did you know that a single bee would have to go to over 2 million flowers to make a single pound of honey?
    13·1 answer
  • What is contact metamorphism?
    5·1 answer
  • Why does the oxygen atom in a water molecule have a negative charge
    12·2 answers
  • What is germination​
    5·2 answers
  • When you are holding a book energy is stored between the book and earth this type of energy called?
    14·1 answer
  • Discuss the theories of opening and closing stomata​
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Fermentation is anerobic respiration he germination of yeast normally yields
    13·1 answer
  • Which strand of mRNA would be made during transcription using the DNA
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!