When climbing a hill or mountain, there are different condions which the body reacts to, first: the body begins to exercise, since it must carry all our weight when climbing up a hill, this generates that the heart accelerates and pumps the blood more quickly so that it reaches our whole body out, and the second one, is that at a higher height, less oxygen, if already, our body comes with the heart shaken by the physical exercise, now it has to accelerate your breathing to get the necessary oxygen for the blood and the body, these two things make us breathe heavily.
Answer: B) Island finches resembled mainland finches, but were not the same species.
Explanation: I took the test
The product of the lac z gene is an enzyme, this enzyme do in the bacterial cell that enzyme is known as β-galactosidase, that's an important a part of the metabolism of lactose.
<h3>What are lactose restriction enzyme ?</h3>
When a restriction enzyme along with BamHI is used to reduce the plasmid, it might reduce the circle at one place. The reduce could open up the circle withinside the LacZ gene. This is due to the fact gene cloners have located a bit of DNA that has many limit enzyme reducing in the LacZ gene.
It cleaves (separates) a disaccharide lactose molecule into a ways greater digestible glucose and galactose lacZ encodes β-galactosidase (LacZ), an intracellular enzyme that cleaves the disaccharide lactose into glucose and galactose.
Read more about the disaccharide :
brainly.com/question/13283251
#SPJ4
Answer: SPORES are defined as haploid (1n) cells which develops into gametophytes.
Gametophytes inturn produce either haploid (1n) male or females GAMETES that can fuse to form diploid ZYGOTES.
This basically explains what goes on in Meiosis.
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
