1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erica [24]
3 years ago
14

Most of the atp supplies for a skeletal muscle undergoing one hour of sustained exercise come from _____.

Biology
1 answer:
ioda3 years ago
6 0

The question is incomplete as it does not have the options which are:

A) creatine phosphate.

B) glycolysis.

C) substrate phosphorylation.

D) oxidative phosphorylation.

E) de novo synthesis.

Answer:

D) oxidative phosphorylation.

Explanation:

The ATP is the energy molecule which provides energy to every metabolic process in the organism.

The ATP in humans is produced by a process called cellular respiration where the last phase of the process called electron transport chain produces the highest amount of protein. The electron transport chain is also known as the oxidative phosphorylation as the oxygen is gained and electrons are lost during the phase.

Thus, D) oxidative phosphorylation is correct.

You might be interested in
Anatomical features that are fully developed and functional in one group of organisms but reduced and functionless in a similar
Tju [1.3M]

Answer:

Answer is option A.

Vestigial features are fully developed and functional in one group of organisms but reduced and function less in a similar group.

Explanation:

  • Vestigial structures are anatomical features such as cells, tissues or organs in an organism that are previously functional and performed some important functions in the organism but no longer serve any functions in the current form of the organism and become useless as a result of a large evolutionary change. Examples include the coccyx or the tailbone in humans, the pelvic bone of a snake, wisdom teeth in humans, nipples in human males, the wings of flightless birds such as kiwi, ostrich, etc.
  • Homologous features are the features that are similar in different organisms having similar embryonic origin and development and are inherited from a common ancestor that also had that feature. Also, they might have different functions. An example is the presence of four limbs in tetrapods such as crocodiles, birds, etc.
  • Analogous features are the features that are superficially similar in different organisms but had separate evolutionary origins i.e., different in origin, but similar in function. An example includes the wings on a fly, a moth, and a bird where the wings were developed independently as adaptations to perform the common function of flying.
  • Polygenic features are the traits or features that are controlled by multiple genes that are located on the same or different chromosomes and are also affected by the environment. These features do not follow Mendel’s pattern of inheritance and are represented as a range of continuous variation. Examples of polygenic traits or features include skin color, height, hair color, eye color, etc. For example, there is wide variation in the human skin color (from light to dark) and height (short or tall or somewhere in between).
  • Sympatry describes a species or a population that inhabit the same geographic region at the same time. In sympatric speciation, new species are evolved from a surviving ancestral species while both the species inhabit the same place at the same time i.e., in a single population, reproductive isolation occurs without geographic isolation.
8 0
3 years ago
What substances are used up as the reactants in cellular respiration?
lana66690 [7]
The cellular respiration happens in the mitochondria. During the cellular respiration, glucose and oxygen are the reactants during this process and the main product of this process is ATP, with waste products carbon dioxide and water. Therefore, the correct answer would be option B. O2 (oxygen) and C6H1206 (glucose).
7 0
3 years ago
Read 2 more answers
Which of the following describes a genotype?
KATRIN_1 [288]

Answer:

The genotype is described as the genes contained in an organisms genetic makeup.

Explanation:

The genetic information contained in the cell nucleus DNA is called genotype. This information resides in the DNA -whose molecules are dispersed in the form of chromatin- which are organized to form chromosomes during cell division.

DNA fragments constitute genes, that contain all the information that determines the anatomical and functional characteristics of a living organism.

Learn more:

Genotype, genes, phenotype brainly.com/question/911764

7 0
3 years ago
How does the male gamete in flowers differ to the animal male gamete?
Anna [14]
<span>The male gamete in flowers differ to the animal male gamete because there is 1 animal male gamete whereas there are 2 male gametes in flowers.</span>
5 0
3 years ago
Which of the following statements explains how N-formylmethionine (fMet) is only associated with the 5' AUG initiation codon and
Scilla [17]

Answer:

  • Only fMet-tRNA(fMet) can bind first to the P site in the ribosome. ( A )
  • There are more than one tRNA with the 5' CAU 3' anticodon. ( B )
  • The N-formyl group attached to methionine prevents fMet from entering  interior positions in a polypeptide. ( D )

Explanation:

The statements that explains how N--formyl methionine (fMet) is only associated with the 5' AUG initiation codon and not with internal AUG codons, given that methionine in both cases in encoded by an AUG in the mRNA are :

Only fMet-tRNA(fMet) can bind first to the P site in the ribosome. ( A )

There are more than one tRNA with the 5' CAU 3' anticodon. ( B )

The N-formyl group attached to methionine prevents fMet from entering  interior positions in a polypeptide. ( D )

While statement C is wrong.

6 0
3 years ago
Other questions:
  • The majority of escapes from correctional facilities involve
    9·1 answer
  • The _____ turned out to be a jaw of a young orangutan attached to the skull of a modern human.
    15·1 answer
  • If you want to set up a controlled experiment to determine the effects of caffeine on sleeping behavior in mice, you take a grou
    6·1 answer
  • Do you think that the soles of of your feet or the back of your neck has the greater concentration of sensory receptors
    7·1 answer
  • Which element provides strength to the exoskeletons of clams and oysters?
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The African clawed frog (Xenopus laevis) is allotetraploid, likely as a result of an interspecies mating long ago, followed by a
    5·1 answer
  • Studying the differences between fossils and modern organisms, like the camel, helps scientists better understand the
    11·1 answer
  • In beans, the black color of the seeds (A) dominates over the white (a). When two bean plants were crossed with black seeds, pla
    10·1 answer
  • What types of weather events are not yet clearly linked to climate change?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!