1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Triss [41]
3 years ago
13

After hormones reach cells, the cells send a chemical signal back to the gland. the signal alerts the gland to continue or two s

top secreting hormones. What is this process called?
Biology
2 answers:
Alina [70]3 years ago
4 0
It is called <span> HOMEOSTASIS :)</span>
MrMuchimi3 years ago
3 0

Answer:

homeostasis is your answer

You might be interested in
Which statement correctly describes a chemical reaction?
o-na [289]

Answer:

C). Bonds between atoms break and reform.

Explanation:

A Chemical reaction is defined as the process in which the substances(two or more) interact and form new substances by rearranging the atom structure of the substances. This process primarily consists of two steps i.e. breaking of chemical bonds that exist between the atoms in the original substances and the formation of new bonds to produce the new substance. Thus, the bonds break and reform. Hence, <u>option C</u> is the correct answer.

4 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Which pictures would best represent Adams in the gas of a neon sign? Explain why
Stella [2.4K]

Answer:

The correct answer is B

Explanation:

The gas particles occupy the entire container that contains them, colliding with the walls of the same, the degree of separation between the particles is large. The gases have no defined shape or volume, are highly compressible

8 0
3 years ago
Why would cellulose be considered a dietary fiber
Vikki [24]

Answer:

Dietary fiber refers to a group of substances in plant foods which cannot be completely broken down by human digestive enzymes. This includes waxes, lignin and  polysaccharides  such as cellulose and pectin. Originally it was thought that dietary fiber was completely indigestible and did not provide any energy.

Explanation:

5 0
3 years ago
A book review would be considered
masha68 [24]
It is definitely not a primary source: this would be a book itself.

Now, is it a tertiary source? I don't think so: the author of the review should have read the book and should only be referring to this book in the review.

I think it's a secondary source.
8 0
3 years ago
Other questions:
  • What ocean contains most of the worlds active volcanoes?
    10·1 answer
  • Which are factors of rock types that affect the rate of weathering? Select three options
    15·1 answer
  • Which is the most common type of arthritis, resulting from wear and tear of joints over the years?
    14·2 answers
  • This simple bacteria cell has the same structure as more complex cells. It controls what comes in to and leaves the cell and als
    6·2 answers
  • Influenza, or the flu, is an infectious disease that affects mammals and birds. The flu cannot be treated with antibiotics becau
    11·2 answers
  • Giving BRAINLIST if you help fast!!
    6·2 answers
  • Which statement correctly describes the diagram?
    7·2 answers
  • Is this a model of an element, a compound, or a mixture? Explain your reasoning. It has to be in your own words.​
    9·1 answer
  • Earth science
    13·1 answer
  • Sound waves travel fastest through what type of material?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!