1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gayaneshka [121]
4 years ago
9

Que es un noviazgo violento en la adolescencia

Health
1 answer:
elixir [45]4 years ago
3 0
Es un comportamiento abusivo usado por uno de los que esta dentro de la pareja lo hacen para mantener poder y control sobre la otra persona. Tambien puede ser física emocional, psicológica, financiera y sexual.
You might be interested in
A skin cell should generate an exact copy of itself. Through which process would this occur?
Pachacha [2.7K]

Answer:

mitosis because mitosis gives rise to genetically identical cells (eg: somatic cells)

6 0
3 years ago
Read 2 more answers
What is the difference between a disease, condition, syndrome and disorder?
rusak2 [61]

Answer:

A disease is a pathophysiological response to internal or external factors. A disorder is a disruption to regular bodily structure and function. A syndrome is a collection of signs and symptoms associated with a specific health-related cause.

6 0
3 years ago
Read 2 more answers
Which of the following statement about the human papilomavirus (HPV) is not true?
ozzi
C. hpv can be cured antibiotics? It can not entirely be cured, antibiotics can only keep it under control
8 0
3 years ago
You are working with a patient who sustained a spinal cord injury resulting in paralysis of the legs. This person has:
meriva

Answer:

A patient with a spinal cord injury that resulted in paralysis of the legs has paraplegia (option c).

Explanation:

Paraplegia consists of paralysis of the lower extremities or legs due to injuries to the spinal cord, from the dorsal vertebrae. Other causes of paraplegia include tumors and malformations that affect the spinal cord.

<u>The spinal cord provides the nerves that allow the innervation of the limbs</u>. A spinal cord injury interrupts communication between the brain and the effector (motor) muscles as well as the sensory nerves in the affected limbs, producing paralysis. When it occurs in the legs is called paraplegia.

The other options are not correct because:

    a. Hemiplegia corresponds to paralysis of upper and lower limbs on one side only.

    b. Pseudoplegia is a paralysis that is due to mental disorders such as conversion disorder, without injury to the nervous system.

    d. Dysplegia is associated with motor disorders observed in children with varying degrees of dysfunction or cerebral paralysis.

4 0
3 years ago
What does it mean when your second toe is longer than your big toe?
Elza [17]
It really mean that is it a beauty mark (seriously). It is not a disability or anything and it common in some people. It is known as "Morton's Toe" or "greek foot". It can make you more susceptible  to foot aches and pains. 

Hope this helps.! :)
5 0
3 years ago
Other questions:
  • P,lz plz help me plzzzzzzzzzzzzzz
    12·1 answer
  • Explain the concept of supply and demand when it comes to grocery store prices
    5·2 answers
  • Why should individuals be prosecuted for statements made on social media?
    11·1 answer
  • A nursing student is listing examples of active and passive health promotion strategies. Which strategy is an example of a passi
    12·1 answer
  • What type of cancer did stuart scott have?
    12·1 answer
  • All of the following describe kwashiorkor and marasmus except
    7·1 answer
  • People who have to avoid certain wheat and grain products or have been born without the ability to digest gluten have
    10·1 answer
  • The sense that enables awareness of the position and movement of body parts is known as
    11·2 answers
  • An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
    12·1 answer
  • Due to alcohol-related reasons, what percent of patients visit the emergency room?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!