1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
11Alexandr11 [23.1K]
3 years ago
15

What is the difference between farming and agriculture

Biology
1 answer:
Mrac [35]3 years ago
4 0

Agriculture is the science and practice of growing crops and rearing animals for human consumption. ... Farming is a more individual practice involving an area of land with buildings on it (as well as fencing, water facilities, etc.), that is used to grow crops and/or rear animals for human consumption.

You might be interested in
Which characteristics describe a spiral galaxy?
Vaselesa [24]
The large majority of spiral galaxies are flat, rotating disks. Within the disk, there are stars, dust, and gas. The disk also contains spiral arms and a central concentration of stars known as the bulge of the galaxy.
7 0
3 years ago
Read 2 more answers
Somebody help me plzzz
Mademuasel [1]

Answer:

B I think because plants have membranes and (I think)animals dont

5 0
3 years ago
Read 2 more answers
Why does the earth have different layers?
Aliun [14]

Answer:

The earth has different layers because as it formed, the lighter parts (like continental crust) floated to the surface, and the really heavy parts (like iron and nickel in the core) sank to the middle. It is just like when you mix oil and water: the oil will float to the surface because it is lighter (or less dense) than the water.

6 0
3 years ago
The images represent sexual and asexual reproduction. These methods of reproduction vary in terms of the genetic
sattari [20]

Asexual reproduction

Sexual reproduction

Explanation:

In asexual reproduction the offspring are genetically identical to the parents.  Asexual reproduction include binary fission, fragmentation and vegetative propagation.

It involves direct inheritance of the genetic copy of the parent without any alteration. The parent gives rise to the offspring without any intermediary process.

In binary fission, the parent simply divides into two to form a new ones.

For sexual reproduction, there is fusion of gametes which carries genetic materials contributed by both parents. The offspring is an offshoot of the genetic combination of the traits of two parents.

Therefore, genetically, offspring produced by sexual reproduction have a distinct copy of the genotypes they posses. They are different from those of the parents.

learn more:

Genetic variation brainly.com/question/3504777

#learnwithBrainly

5 0
4 years ago
Read 2 more answers
Process of a structure of a specialized cell.
ikadub [295]

Answer:

Specialized cells are the cells though they are similar, but cells differ in size, shape and depending upon their function in body.

Example of specialized cells are: Blood cells, Nerve cells, Reproductive cells.

Tissues are made up of specialized cells, those tissues make up organs, organs make up system and systems make up bodies.

3 0
3 years ago
Other questions:
  • The brain of a person with alzheimer's disease shows excessive amounts of
    15·2 answers
  • Plzzzzzzzzzzzzzzzzzzzzz helppppppppppp im being timeddddddddd
    8·1 answer
  • Again, frederick compares the treatment of slaves to the treatment of horses. how?
    10·1 answer
  • Explain the relationship between each pair of term:
    5·1 answer
  • Explain the relationship between species richness, relative abundance, and diversity.
    9·1 answer
  • How does the insulin receptor differ from the erythropoietin receptor?
    8·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The products of photosynthesis are the...
    11·2 answers
  • An advantage of our scientific naming system is that
    9·1 answer
  • 5. In the following chemical equation, ____ and ____ are
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!