1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rufina [12.5K]
3 years ago
11

Why is deep ocean water almost completely isolated from the atmosphere?

Biology
1 answer:
tigry1 [53]3 years ago
6 0

Answer:

B

Explanation:

I had a test on that two days ago

You might be interested in
Is MRSA a eukaryotic or prokaryotic structure?
Sergeeva-Olga [200]

MRSA is a prokaryotic structure

6 0
3 years ago
Can someone pls help? Thx!!
Pachacha [2.7K]

he correct answer is number one. A chromosome is composed of many genes. A chromosome is referred to as a DNA molecule in an organism's body, which consists of genetic materials. Chromosomes consists of numerous genes within them, in their nucleus and mitochondria, genes are found inside the Chromosomes itself

4 0
3 years ago
Read 2 more answers
If you have black hair and
oksian1 [2.3K]

Answer:

Codominance

Explanation:

In genetics, codominance refers to a type of inheritance in which two variants (alleles) of the same gene are expressed differently in one individual, resulting in different phenotypes.

7 0
2 years ago
Which of these substances are greenhouse gases? Check all that apply. Oxygen carbon dioxide water vapor methane nitrous oxide
Arisa [49]

Which of these substances are greenhouse gases?

<h3>carbon dioxide </h3><h3>water vapor </h3><h3>methane </h3><h3>nitrous oxide</h3>

Those are answer's <em>I chose</em>, if there are <u>more</u> or <u>less</u>, please correct me.

Please give a <u>brainliest</u> and a <em>thanks</em>.

<h2>❣</h2>
5 0
3 years ago
Read 2 more answers
The quality of pond water can be determined by identifying the number and types of organisms found living in the water. which pi
Zolol [24]
I have a few options:
Microscope
Nets
Lab
5 0
3 years ago
Other questions:
  • Explain, using the concept of genetic inheritance, how a complex like a mammal acquires it’s physical traits form both its paren
    10·1 answer
  • "Spent" nuclear fuel rods come out of a reactor and need to be handled carefully. Why must power plants spend so much money and
    5·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • What were two factors that caused a decrease in the rabbit population?
    15·1 answer
  • The blood type of the donor and recipient must be compatible for a blood transfusion to occur. If they two are not compatible, a
    9·1 answer
  • What do you mean by the term,' Weed'?​
    13·1 answer
  • mitosis produces ___ new cells which are _______ to the original cell from which they came. They have the ____ number of _______
    14·1 answer
  • How is gene transcribed
    5·1 answer
  • Which of the following molecules is not required for a PCR reaction? View Available Hint(s) Which of the following molecules is
    11·1 answer
  • Which body part contains the most number of mitochondria??
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!