1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ioda
3 years ago
12

The portion of the diencephalon that acts as a relay station for sensory impulses traveling to the sensory cortex is the _______

_.
Biology
1 answer:
Hitman42 [59]3 years ago
4 0

Answer: Thalamus

Explanation:

The thalamus part of the brain is known as the relay station for all the sensory information. This information can be any sought of smell, light, taste et cetera.

It is relayed further via thalamus. Myelinated fiber bundle originates from the lateral surface of thalamus and it terminates at the cerebral cortex.

It is a relay station for the information from brainstem, spinal cord and cerebrum towards the cortex.

You might be interested in
in a clade, mammalian has the three descendents: monotreme, marsupials, and eutheria. What will these three descendants together
Tems11 [23]
I think sister groups. Imagine them having the same parents.
5 0
2 years ago
What is the trait that is ancestral to all chordates?
Alla [95]
<span>The trait that is ancestral to all chordates is the presence of a notochord...the others are gill slits and nerve chord</span>
3 0
3 years ago
Read 2 more answers
Which of the following types of models is most likely to be used to predict earthquakes?
8090 [49]

Answer:

its B

Explanation:

3 0
2 years ago
How is the FOG produced?
gayaneshka [121]
Fog begins to form when water vapor condenses into tiny liquid water droplets that are suspended in the air.
3 0
2 years ago
Read 2 more answers
How does a slow moving front differ from a fast moving front?
sashaice [31]
Fast-moving cold fronts force the warm air ahead of them to rise more quickly than slow movers. The clouds and rain are mostly along the front or ahead of it, and heavy rain or thunderstorms are common. A slow-moving front lifts the warm air more gradually; the rain is less intense, and the clouds form along and *behind* the surface cold front.
3 0
3 years ago
Other questions:
  • How energy is transferred through a food web and food chain using the law of conservation of energy?
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Sea anemones and sea stars both eat mussels and crabs. The abiotic factors in a tide pool caused a growth in the sea star popula
    5·1 answer
  • Do-it-yourself DNA-analysis kits can be ordered online and administered in the comfort of your own home. True False
    6·2 answers
  • What type of bond if formed when electrons are shared between atoms ?
    7·2 answers
  • Which life functions do viruses not preform
    13·2 answers
  • Help ASAP! Please! Ill mark brainliest
    5·1 answer
  • How can Fungus effect Bacteria?
    13·2 answers
  • ILL GIVE WHO EVER HELPS BRAINLISEST ANSWER
    15·2 answers
  • Characteristics such as eye color, that are passed from one generation to the next, are known as ______.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!