1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
garik1379 [7]
3 years ago
6

Which statement best describes the phases of the Moon?

Biology
1 answer:
Deffense [45]3 years ago
3 0

Answer:

During the waning phase of the Moon, less of the Moon's near side is lít each night

Explanation:

Phases of the moon are different ways the moon appear on the Earth. As moon orbit the Earth, half of the moon that faces the Earth will be lit up. There are different phases of moon which are full moon, quarter moon, waning crescent moon, waning gibbous moon, e.t.c.

A waxing crescent moon is when the moon look like crescent and it increases in size.

A waning gibbous moon occurs when more than half of the lit portion of the Moon can be seen and the shape reduce in size . It occur between the full and quarter moon.

You might be interested in
What makes one protein different from another one?
NARA [144]
Proteins differ from one another primarily in their sequence of amino acids
4 0
3 years ago
Read 2 more answers
Which is an example of how the perpheral nervous system helps the body maintain its internal environment
sladkih [1.3K]

Answer:

Muscles produce keratin so that hair can grow stronger. Sweat glands break down the food that is consumed. Muscles contract rapidly to produce heat on a cold day.

Explanation:

8 0
3 years ago
Which structure is responsible for the voice?
Eddi Din [679]

Answer:

larynx

Explanation:

The larynx is the voice box. The vocal folds are part of the larynx. The vocal folds vibrate to create the sound of the voice.

7 0
3 years ago
The central dogma of molecular biology states that DNA is _______ into mRNA, which is then translated into polypeptides.
Gnom [1K]
1. transcribed

2. cytoplasm

3. transfer RNA
3 0
3 years ago
Read 2 more answers
Explain the differences in the three types of RNA by connecting it to a factory.
kykrilka [37]

{\huge{\sf{\green{\underline {\underline {Answer }}}}}}

  • Three major types of RNA are mRNA, or messenger RNA, that serve as temporary copies of the information found in DNA; rRNA, or ribosomal RNA, that serve as structural components of protein-making structures known as ribosomes; and finally, tRNA, or transfer RNA, that ferry amino acids to the ribosome to be assembled .

  • RNA carries genetic information from the nucleus to ribosomes for the synthesis of proteins; while tRNA carries specific amino acids to the ribosomes to assist the protein biosynthesis, and on the other hand, rRNA provides the structural framework for the formation of ribosomes.

HOPE IT HELPS YOU.....

8 0
3 years ago
Other questions:
  • Suppose concordance data were collected from a cohort study of twins to study the genetic contribution to the onset of type 1 di
    13·1 answer
  • Statistical measures of change in an economy are called:
    9·1 answer
  • Which of the following best describes a carbohydrate?
    14·2 answers
  • A school of minnows living in the same environment would represent which of the following? A- a community B- an organism C- an e
    5·1 answer
  • What is a negative impact about engineer plans may have on the environment
    9·1 answer
  • Which discovery did Gregor Mendel make?
    10·2 answers
  • Which process is part of the carbon cycle?
    10·1 answer
  • Destin Benning: Attempt 5
    14·1 answer
  • Name the process that has taken place when u put pebbles in water​
    12·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!