3 years ago

Among the following scientists, which one is known for developing the laws of heredity?

1 answer:

4 0

Among the following scientists (Michael Faraday, Albert Einstein, Gregor Mendel, and Charles Darwin), the one who is known for developing the laws of heredity is C) Gregor Mendel.

You might be interested in

Unlike toads, tortoises

Tju [1.3M]

<span>B. have amniotic eggs.</span> Frogs and toads don't have amniotic eggs. Frogs and toads lay "frog's spawn" these are clumps of eggs covered with jelly like substance. Frog's spawn may contain thousands of eggs.

7 0

3 years ago

in which of the following substances is a plant more likely to fossilize a)mud b)sand c)gravel d)magma

NeTakaya

I'm not sure, but I think it would be mud.

3 0

3 years ago

The products of spermatogenesis are

maxonik [38]

B is the answer tomthis

5 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

What process enables the bacteria to multiply inside the body?

Ksenya-84 [330]

When bacteria is divided in to two it is called binary fission, but there is also a process called conjugation

7 0

3 years ago