1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dima020 [189]
3 years ago
9

In some zoos, rare crosses between a male lion and a female tiger have produced hybrid offspring called ligers. male ligers are

sterile but some female ligers are fertile. in the wild, lion and tiger ranges do not naturally overlap, making such a cross unlikely. furthermore, the solitary behavior of tigers and the social organizations of lions create behavioral differences. the natural differences in the ranges of wild tigers and lions is an example of ______.
Biology
1 answer:
astra-53 [7]3 years ago
5 0

Answer:

Habitat isolation

Explanation:

It is a type of reproductive isolation between species, also referred to as allopatry, where they are kept apart by geographical barriers such as in this case, the large ranges that do not overlap. The behavioral difference between tigers and lions is a type of sympatry reproductive isolation  where even though the two species encounter frequently, behavioral isolation prevents them from  interspecies reproduction.

You might be interested in
What is occurring in the endocrine system during a "fight or flight" response?
Lapatulllka [165]
You're answer would be A. Release of adrenaline by the adrenal glands.
3 0
3 years ago
Read 2 more answers
Explain what is meant by 'root cells are hairy'
Viktor [21]
Hairy root culture<span>, also called </span>transformed root culture<span>, is a type of </span>plant tissue culture<span> that is used to study plant metabolic processes or to produce valuable </span>secondary metabolites<span> or recombinant proteins, often with plant </span>genetic engineering<span>.</span>
3 0
3 years ago
Read 2 more answers
Class ii mhc proteins are found on which of the following cell types?
Bogdan [553]

Answer:

The answer to the question: Class II MHC proteins are found on which of the following cell types, would be: on macrophages and lymphocytes, particularly T-Cells.

Explanation:

MHC, or Major histocompatibility complex, is a very important part of the immune response that the body gives against an invading pathogen, or other foreign substances. There are three types in the human body, Class I, Class II and Class III and each of them will play a role on the cellular membrance of different types of cells and mediate different types of responses. In the human body, this histocompatibility complex is best known as HLA, or human leukocyte antigen, and it will ensure the recognition, or non-recognition of substances, tissues, and other organisms, by the human immune system. Class II, as mentioned before, are most usually found on the immune cells macrophages and lymphocytes, and they are the ones responsible for presenting antigens to these proteinic antibodies so that the immune cells can initiate a proper immune response.

5 0
3 years ago
What is it called when a oceanic and continental crust come together?​
scoray [572]

Answer:

Ocean-Continent Convergence

Explanation:

8 0
3 years ago
In which type of environment might water soluble rocks such as limestone or dolostone become ridge formers?
Sergeeva-Olga [200]
I would say that the most likely environment for these two rock types to be ridge formers would be an arid climate like a desert where there was little water to dissolve. Also, even in a normal temperate environment, dolomite can form a very resistant ridge or cliff former as is the case with the Palliser Formation in Banff Park which forms a pronounced cliff which is very extensive.
8 0
3 years ago
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Match each biome with the correct description.
    8·2 answers
  • 3. What is different about the blood carried by the arteries going to the body and the blood carried by the arteries going to th
    8·1 answer
  • Black-bellied seedcrackers have either small beaks (better for eating soft seeds) or large beaks (better for hard seeds). There
    9·2 answers
  • Which of the following types of waves has more energy than an x-ray
    10·1 answer
  • Identify the cavity that develops entirely from the mesoderm.
    10·1 answer
  • When doing medical research with human subjects, which four limitations are unavoidable?
    5·1 answer
  • Which best describes the alternation of generations? Fertilization produces haploid spores. Meiosis produces a diploid zygote. A
    9·2 answers
  • Mrs. Cruz has blood type A, while his husband Mr. Cruz has blood type B. Their first and second child is type A and type B respe
    10·2 answers
  • Which of these can affect the results of biometrics systems, according to "the biometric body"? a. Aging b. Blinking c. Thinking
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!