1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ahrayia [7]
3 years ago
13

In meiosis 2 what happens during telophase and cytokinesis?

Biology
2 answers:
DENIUS [597]3 years ago
5 0
<span>A total of four haploid cells are formed.</span>
timurjin [86]3 years ago
4 0
A total of four haploid cells
You might be interested in
Que tipo de celula es un virus
Feliz [49]

Answer:

Un virus no es una célula sino un organismo microscópico que invade las células de sus huéspedes.

Explanation:

5 0
3 years ago
Please help me with this quiz
ra1l [238]

Answer:

snoop dog yeah yeah lol

Explanation:

im good

7 0
3 years ago
A client with newly diagnosed multiple myeloma asks, "how long do you think i have to live?" what is the most appropriate respon
AleksandrR [38]
<span>The most appropriate response would be for the nurse to ask the patient about their current concerns. This allows for the patient to actually elucidate what he or she is feeling at the time and does not hamstring the provider into actually giving a set length of time that they feel the patient has left to live, which can vary greatly from person to person.</span>
6 0
3 years ago
Which scientist made x-ray diffraction photos of dna?
Marrrta [24]

Rosalind Franklin. is the answer

5 0
2 years ago
Read 2 more answers
What skills and education do careers in agronomy require?
Lynna [10]
To be an agronomist, you should have an interest in science and a bachelor's degree. In college take agriculture, biology, chemistry, mathematics, physics, and statistics courses, as well as broad based general education courses, including English and speech. Hope this helps your question.
8 0
2 years ago
Other questions:
  • Gregor Mendel used pea plants that were heterozygous for each of two traits—seed color and seed shape—to generate a dihybrid cro
    8·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which type of transport is responsible for oxygen entering into blood cells
    7·2 answers
  • Which type of archaebacteria lives in the intestines of cows?
    8·2 answers
  • Las flores son abioticas o bioticas​
    13·1 answer
  • How has the environment of this location changed since Basilosaurus lived?
    11·1 answer
  • HELP ASAP WILL MARK BRAINLIEST! Idk if my answer is right please help
    9·1 answer
  • In which phase of mitosis do the sister chromatids get pulled apart to opposite ends of the cell?
    12·2 answers
  • What three taxa do all these organisms have in common?
    15·2 answers
  • How do axial filaments differ from regular bacterial flagella?.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!