1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kompoz [17]
2 years ago
7

In red shift, the wavelengths of light become:

Biology
1 answer:
lukranit [14]2 years ago
7 0

Answer:

The light is shifted to the red end of the spectrum, as the wavelengths get longer.<em> </em>

You might be interested in
What process is most important in the expansion of plant cells?
Stella [2.4K]
Water uptake, water is 90% of the plant cells expansion
8 0
3 years ago
What are the primary components of the juxtaglomerular apparatus? check all that apply?
KIM [24]
<span>The juxtaglomerular apparatus is a structure (formed by the distal convoluted tubule and the glomerular afferent arteriole) with the function in the regulation of blood pressure and the filtration rate of the glomerulus. Its primary components are:
</span> <span><span>·     </span>the macula densa- specialized epithelial cells in the distal convoluted tubule (detect Na concentration),
</span> <span><span>·     </span>juxtaglomerular cells- formed from the smooth muscle cells of the afferent arteriole (secrete renin),</span>
<span><span>·     </span>extraglomerular mesangial cells (lacis cells)-unknown function.</span> <span> </span>
7 0
3 years ago
Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation. One of the processing
AnnyKZ [126]

Answer:

Statements that are true are:

B) in splicing, intron sequences are removed from the mRNA in the form of lariats (loops), and are degraded = TRUE

C) one mRNA can sometimes code for more than one protein by splicing at alternative sites = TRUE

E) splicing occurs while the mRNA is still in the nucleus = TRUE

Statements that are false are:

A) splicing occurs while the mRNA is attached to the nucleosome = FALSE

D) splicing of mRNA does not involve any proteins = FALSE

4 0
3 years ago
What are the similarities and differences between a source rock and a metamorphic rock?
shtirl [24]
Sedimentary rocks form when sediments come together and forms the rocks, while metamorphic rock are those formed when sedimentary and igneous rocks compress under great heat and pressure.
8 0
3 years ago
Which statement best explains why less energy is available to organisms as a food chain gets longer?
Aleks [24]
<span>This is due to much of the energy that is consumed by lower trophic levels of the food chain/food web being used at that lower level. This energy is stored or used and, therefore, unavailable to the organisms higher up in the chain. As the chain lengthens, less energy is available, usually as a factor of 10 (1/10 of the energy taken in by the level below the consumer is available to the consumer's level, for example).</span>
4 0
2 years ago
Read 2 more answers
Other questions:
  • What impact has "tavy" farming had on Madagascar's environment? Describe at least three effects of this practice. (Site 1)
    14·2 answers
  • Need the answer to this quickly!!!!!!!
    6·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • 1. To calculate the frequency of the brown allele, count the number of and divide by the total number of alleles in this populat
    6·1 answer
  • Which rna is blueprint for genetic code
    9·1 answer
  • 4) What can we see in the sky because of gravity?
    13·2 answers
  • The enzyme pepsin is produced in the cells of the stomach but not in the cells of the small intestine. The small intestine produ
    13·1 answer
  • Identify part A, B and C. What is the function of part B?
    15·1 answer
  • How many hydrogen atoms are present in each water molecule?
    7·1 answer
  • Alpa wants to change 0.54 kilometers into a smaller metric unit. She will have to
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!