1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lyrx [107]
3 years ago
9

In animals, the production of body cells is classified as asexual reproduction, but the production of reproductive cells or game

tes is part of sexual reproduction. Which statement BEST describes the gene sequencing? A) The number of genes in the parent body cells is equal the number of genes in the daughter body cells. B) The number of genes in the parent body cell is double the number of genes in the daughter body cells. C) The number of genes in the parent reproductive cell is equal to the genes in the daughter reproductive cells. D) The number of genes in the parent reproductive cell is half the number of genes in the daughter reproductive cells.
Biology
1 answer:
maw [93]3 years ago
5 0
I think its <span>B) The number of genes in the parent body cell is double the number of genes in the daughter body cells.</span>
You might be interested in
Why is knowledge of both human anatomy and human physiology necessary?
marshall27 [118]

An understanding of anatomy is key to the practice of health and medicine

6 0
3 years ago
PLEASE ANSWER THIS!
Veseljchak [2.6K]

Answer:

because when you do it on accident it is unintentional and scares you because you werent expecting it. but when you do it on purpose it wont hurt because your brain stops you from doing it so hard that it hurts lol

Explanation:

6 0
3 years ago
Cuál de estos se desgasta más rápido una piedrita redonda y lisa o una pieza de roca áspera y porque
gizmo_the_mogwai [7]
Una pieza de roca áspera. I'm only guessing <span />
3 0
3 years ago
Neurons conduct and receive information from other neurons in the form of electrical currents. the receiving end of the neuron i
777dan777 [17]
Dendrite; axon; synapse

These are parts of the neuron which is considered as the basic unit of nervous system. The cell responsible for receiving sensory input from the external environment. The stimulus will be transported in an electrical signal via neuronal parts. Axon transmit signal to the other neuron. Dendrites are the receiving part of the neuron. Synapse is the space between each neuron where elctrical impulse is converted into a chemical signal via neurotransmitters.

8 0
3 years ago
Living organisms can incorporate ________ into their metabolism.(1 point)
Dmitrij [34]

Answer:

nitrates

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which cell contains membrane bound organelles in addition to a cell wall and chloroplast
    9·2 answers
  • According to the text's definition, nutrition is "the proper supply of nutrients essential for": growth reproduction circulation
    8·2 answers
  • I’m not sure what the answer is ??
    6·2 answers
  • Read the following scenarios carefully and explain how natural selection will occur in each.
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Hiii! So I was doing science, and it's not my best subject. And on one question, I was stuck, so I came to Brainly to see if any
    11·1 answer
  • H20 os a compound formed by its atoms' sharing
    7·1 answer
  • How does the process of hydration cause chemical weathering?
    13·1 answer
  • What molecule did the work of Griffith, Avery, Hershey &amp; Chase confirm was the molecule that made up genes?
    6·1 answer
  • What explains why birds fly south for the winter
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!