What happens to the total population when the birth rate is at 40 and the death rate is at 15?

2 answers:

4 0

If the birth rate in a population is 40, and the death rate in that population is 15, then the population will be experiencing growth. The growth will be 25 on every 1,000 people. If this trend continues for longer period, then the population will start to become younger and younger, making the basis of the population pyramid wider, while the top part of it smaller and smaller. This demographic situation in modern times seems to be present only in the less developed countries, with the majority of the transitioning countries having much decreased population growth, and the more developed countries having more deaths than births, thus being aging populations.

olchik [2.2K]3 years ago

3 0

Answer:it increases

Explanation:

You might be interested in

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

liubo4ka [24]

The mRNA generated below was produced in the nucleus of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.