1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Evgen [1.6K]
3 years ago
8

The codon AUG specifies the amino acid methionine. What would the tRNA anitcodon be that recognizes this codon?

Biology
1 answer:
NemiM [27]3 years ago
6 0

Answer:

UAC

Explanation:

This example portrays that translation, which is the second process of protein synthesis, is about to occur. Translation cannot occur without a special type of RNA called tRNA or transfer RNA.

A tRNA contains a set of three nucleotides called ANTICODON. The tRNA matches an mRNA codon with the amino acid it encodes. The tRNA initially binds to the mRNA and reads the mRNA codon using its anticodon (which is complementary to the mRNA's codon). The actual reading is done by matching the base pairs through hydrogen bonding following the base pairing rule i.e. A-U, G-C. After reading the mRNA codon using its anticodon, it then carries the specific amino acid encoded by that codon it binds to, in order to add to the growing polypeptide chain.

For example, a codon AUG (start codon that signals beginning of translation) will be read by tRNA anticodon, UAC. Since the codon AUG codes for amino acid, Methionine. The tRNA then carries Methionine via its amino acid attachment site and adds to the polypeptide chain (future protein).

You might be interested in
Spongy tissue is best described as dense smooth and homogenous<br> True or false
jekas [21]
False, it’s compact
5 0
3 years ago
Which formations are features of karst topography? Select three options. caves sinkholes stalagmites oxbow lakes underground lak
madreJ [45]

Answer:

oxbow lakes, underground lakes, and stalagmites.

Explanation:

5 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Why would fossils found at the top of a canyon probably be younger than those found at the bottom of the canyon?
FinnZ [79.3K]

Answer:

The farther up they go, the more recent the layers were created

Explanation:

7 0
3 years ago
Read 2 more answers
Which two natural resources will be most affected as people try to meet the growing demand for food?
Jet001 [13]

Answer:

water and land

Explanation:

I assume this is an open-ended question, so you could make an argument for lots of things, but these are the two most important ones in my opinion. The amount of freshwater on Earth is pretty small, only about 2.5%, and most of that is locked in ice. As the demand for food grows, the demand for water for crops and livestock also grows. This is in addition to the increase in water that is needed for a growing population. Climate change increases this problem because of drought. The second most important resource that will be affected is land. If we need more food, we also need space to grow crops and raise livestock. The available space is also reduced because people need places to live and we need to be able to grow trees for wood to build houses and other buildings. I argue that land and water will be the most in-demand commodities as the population continues to increase.

6 0
2 years ago
Other questions:
  • What is the ratio of surface area to volume for a sphere with the following
    10·1 answer
  • Plants have chloroplasts in their cells that give them a green color. What is the function of the chloroplasts in plants?
    10·2 answers
  • Explain how the invention of the motor vehicle has been both beneficial and harmful?
    10·1 answer
  • What happens during the experiment stage of the scientific method
    9·1 answer
  • Vercuronium and rocuronium are used to
    6·1 answer
  • Which of the following best explains how hydrogen bonding affects the heat of vaporization for water?
    10·2 answers
  • explain whether or not offsprings get more genes from one parent or get an equal number of genes from each parents. What evidenc
    15·1 answer
  • What is the summary of this section of we need batteries
    7·2 answers
  • 4. What is the difference between cytology and histology?
    9·1 answer
  • What is a natural, nonspecific immune response, but it is part of the body's second line of defense?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!