1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulsSmile [24]
3 years ago
11

An athlete would like to supplement his diet with the highest concentrate whey protein. What form of whey protein is recommended

?
Biology
1 answer:
AveGali [126]3 years ago
3 0

Answer:

Option B

Explanation:

Complete question -

An athlete would like to supplement his diet with the highest concentrate whey protein. What form of whey protein is recommended?

A. Whey protein powder

B. Whey protein isolate

C. Whey protein concentrate

D. Whey protein with casein

Solution -

Whey protein is taken by people who are intolerant to lactose. Among all the forms of why protein, whey protein isolate consists of 95 percent of protein and hence is the purest form of whey protein. Also the lactose concentration is negligible or absent. This protein also consists of low fat as compared to other forms of whey protein and due to all these features it is a bit costlier than other forms of whey protein

You might be interested in
What do anaerobic photosynthesizing bacteria from early Earth have in common with all organisms today?
miskamm [114]
The answer is :they passed on their genetic material to new cells when they reproduced.
Explanation : Well when cells undergo division , they pass on their genetic material , so that's the same way that bacteria passed and still passes it's genetic material by the process of rep
roduction.
Hope this helps :)








5 0
4 years ago
Read 2 more answers
What are the major functions of fatty acids and triglycerides in the body?
Natali [406]

Answer:

Triglycerides, cholesterol and other essential fatty acids.

Explanation:

the scientific term for fats the body can't make on its own—store energy, insulate us and protect our vital organs. They act as messengers, helping proteins do their jobs.

5 0
3 years ago
What part of the human body is most similar in function to the spongy mesophyll layer in a leaf?
Whitepunk [10]
The part of the Human body that is most similar in function to the spongy mesophyll layer in a leaf is A) Alveoli in the lungs.
7 0
3 years ago
A malaria outbreak causing allele frequencies to change is an example of
Nina [5.8K]
<span>This would be an example of a mutation, because the changing of allele frequencies would be a change within the gene itself, which would be a mutation in the DNA. This is evidenced by the fact that there is now a form of human resistance to malaria, due to changes within human DNA itself.</span>
6 0
3 years ago
In addition, sperm receive a chemical fluid from the _____________. (This is the most common site of cancer in older men.)
larisa86 [58]

Answer:

b prostate gland

Explanation:

The prostate gland's main function is to secrete prostate fluid, one of the components of semen.  The prostate is also a common site of cancer.

5 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Why do animals need a regular supply of carbohydrates?
    14·1 answer
  • A comet orchid has creamy white-colored flowers and a characteristic "tail" that contains the flower's nectar. this orchid does
    9·1 answer
  • The solid waste produced by a sewage-treatment plant is called _____. slimy discharge sludge runoff
    9·1 answer
  • A ball is thrown in the air. The ball goes up, then changes direction and falls down. Why does the ball fall down? Gravity pushe
    11·2 answers
  • There is only one pathway by which rocks move through the rock cycle. <br> a. True <br> b. False
    9·2 answers
  • The cowbird is a nest parasite that lays its eggs in the nests of other species in the trees along the boundaries of forests and
    13·1 answer
  • Which molecule is a source of carbon, hydrogen, and oxygen atoms for making proteins?
    10·1 answer
  • Describe one way the student could change the intensity of light reaching<br> the pondweed.
    10·1 answer
  • Human skin comes in a variety of
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!