first left (up) trachea
first left (down) diaphragm
right (up) bronchiole
right (down) alveolus
To identify people by DNA it is better to make copies of non-coding segments because they exhibit more variation than genes.
- The polymorphic sequences of non-coding DNA vary between individuals in humans.
- Variable number tandem repeats, or VNTRs, are created when DNA sequences are repeatedly replicated in the genome's non-coding regions.
- It is possible to create a person's genetic fingerprint by counting the amount of repeats, which varies between individuals.
- However, this non-coding DNA is used in criminal investigations by forensic experts.
- There are distinctive repeating patterns found inside this area of DNA that can be utilized to distinguish one person from another.
- Short tandem repeats (STRs) are a type of pattern that can be measured to determine a person's DNA profile.
learn more about DNA here: brainly.com/question/21265857
#SPJ4
Answer:
The answer is a Carbohydrate!
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
