Answer:
C) predation
Explanation:
Such an insect would serve as a prey to a predator in a prey-predator relationship. Such relationship is a predation.
Predation is an act of feeding in a prey. The preys are weaker and smaller organisms which can easily be overpowered by the bigger predators.
When an insect evolves to resemble a plant twig, it is an evolutionary mimicry. Such organism that evolves must be prey. This presents the prey an evolutionary advantage for it to be evaded by the devouring predator. Mimicry is an evasive tactics.
In parasitism, one organism benefits while the other, the host, suffers from the relationship. Here, the parasite is lives inside the host. A mimicry won't apply here.
Answer: I would say Felsic.
Explanation: There are many other names for Igneous Rocks. Felsic or Silicate. then there's Phaneritic, Aphanitic, Plutonic Rock, Volcanic Rock, Intrusive, Extrusive, and also Porphyry.
Six molecules of carbon dioxide plus six molecules of water plus light energy converts to six molecules of oxygen plus sugar, Thus, the correct option is A.
<h3>
What is photosynthesis?</h3>
Photosynthesis is the process through which plants use sunlight to create their own nourishment. Through a sequence of reactions, light energy from the sun is turned into chemical energy, which is then stored in the form of food.
In the presence of sunlight, 6 molecules of carbon dioxide (CO2) and 6 molecules of water (H2O) react to form 1 molecule of glucose sugar. During photosynthesis, 6 molecules of oxygen are formed in addition to glucose.
The following is a balanced chemical reaction for photosynthesis:
Sunlight
6CO2 + 6H2O —---------> C6H12O6 + 6O2.
(carbon (water) (glucose) (oxygen)
dioxide)
For more information regarding photosynthesis, visit:
brainly.com/question/3529377
#SPJ1
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
Capillary refill time
Explanation:
Capillary refill time refers to the time that it takes for color to return to an external capillary bed after pressure has been applied (which causes blanching). Usually, on healthy individuals, capillary refill time takes less than 2 seconds. If the time is much longer, this could indicate problems such as shock, dehydration or peripheral artery disease.
