1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Debora [2.8K]
3 years ago
10

What surrounds all cells

Biology
2 answers:
erik [133]3 years ago
7 0
The Cell<span> membrane </span>surrounds<span> all living </span>cells<span> and is the most important organelle, there is also a similar plasma membrane that </span>surrounds<span> all the organelles except for the ribosome. It is composed of phospholipids, proteins, and carbohydrates, which are arranged in a fluid mosaic structure.</span>
defon3 years ago
7 0
A membrane surroundes the human cell and a cell wall surrounds a plant cell
You might be interested in
If a plant is considered “drought-resistant“ does it require more or less water to perform photosynthesis?
leonid [27]

Answer:

Less water.

Explanation:

If the plant is "drought-resistant" then that should mean less water is required for the plant to perform photosynthesis.

6 0
3 years ago
Cold food should be received at or below an internal temperature of
alexdok [17]

0-4 degrees Celsius, below which bacteria grow very slowly.  This is the same as refrigerator temperature.

Please use __________ to indicate fill-in-the-blank questions.

Otherwise the question could end up being deleted for incomplete question.

7 0
3 years ago
Brainliest to the best and correct answer!!!
charle [14.2K]

Explanation:

plant growth. you can create a hypothesis like "the plant grows better in blue light! "

4 0
3 years ago
Loess is soil formed by
zzz [600]

Loess is a geologically material which is usually yellowish or brown in color and consisting of tiny mineral particles brought by wind to the places where they now lie. It is a sedimentary deposit of mineral particles which are finer than sand but coarser than dust or clay, deposited by the wind. Loess is a type of silt which forms fertile topsoil in some parts of the world. The soil has few clay particles to hold it together. It is composed mainly of quartz crystals which slide easily against each other, and is therefore very subject to erosion.

4 0
3 years ago
Read 2 more answers
30 POINTS
vivado [14]
The answer is  C because it is takeing away part of its habitat which would make it's carrying capacity lower which means they cannot have as big of a population. 
3 0
3 years ago
Read 2 more answers
Other questions:
  • Teeth patterns in animals and thorns in plants are examples of characteristics that a taxonomist might observe for keying.
    11·2 answers
  • During an expedition, a scuba diver saw an animal use stinging tentacles to capture and eat its prey. Which animal did the diver
    14·2 answers
  • Describe how enzymes affect chemical reactions and explain why this makes enzymes important to living thing.
    11·2 answers
  • The main difference between prokaryotic and eukaryotic cells is that
    12·2 answers
  • How do you feel about using solar panels?
    6·2 answers
  • Genes alone do not determine development; environmental forces also shape development. This information has led to the understan
    7·2 answers
  • explain the how protein contained in seeds or milk is useful for the plant sprouting from the seed or the baby mammal
    10·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which sentence describes one difference between DNA and RNA?
    9·1 answer
  • He warning label that appears on products containing nutrasweet (aspartame) is necessary to prevent problems for people with ___
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!