1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pickupchik [31]
3 years ago
14

Which mutation occurs when one nucleotide base is replaced with another base

Biology
2 answers:
astra-53 [7]3 years ago
8 0

Answer: substitution

Explanation:

svetlana [45]3 years ago
6 0

The correct answer is a substitution mutation.  

A mutation, which substitute’s one base for another, that is, a change in a solitary chemical letter like switching an A to a G is known as a substitution mutation. This kind of substitution can modify a codon to something, which encrypts a distinct amino acid and leads to a small modification in the generated protein.  


You might be interested in
15. DNA replication is said to be semi-conservative. What does that mean?
sveta [45]

Answer: dna replication would be semi-conservative because they produce two copies. one being the original one and then the new one

Explanation:

4 0
4 years ago
In 2010, an oil rig exploded and sank in the Gulf of Mexico. This oil spill has become known as the ____.
const2013 [10]
A. The Deepwater Horizon

Hope this helped!
3 0
2 years ago
Do all three bird species occupy the same niche? Explain .
Rus_ich [418]

Answer:

None of the birds have the same niche.

Explanation:

They all have different niches because of the food they ate. Over time, they were gentically changing to adapt to their own food.

7 0
3 years ago
The CRISPR system
Rzqust [24]

Answer:

The correct answer is b. recognizes foreign DNA sequences that have previously entered the cell and directs the Cas proteins to destroy them.

Explanation:

Clustered regularly interspaced short palindromic repeats (CRISPER) is the sequences of DNA found in the genome of prokaryotes and archaea. These sequences are added at a crisper locus in DNA by bacteria through capturing bacteriophage DNA during infection.

Then this sequence is used to detect a similar sequence of bacteriophage during subsequent infection and destroy them by Cas9 enzyme. Cas 9 enzyme uses a crisper sequence as a template to destroy similar phage DNA.  

So the CRISPER Cas system provides an adaptive defense mechanism to bacteria against foreign DNA coming from bacteriophage. Therefore the correct answer is b.

3 0
4 years ago
What biomolecule is useful for a fast source of energy?
MissTica

Carbohydrates are useful for a fast source of energy.

<h3>What are Carbohydrates?</h3>

The body swiftly breaks down simple carbs for use as fuel. Natural sources of simple carbs include fruits, milk, and dairy products. They can also be discovered in sugars that have been processed and refined, such as confectionery, table sugar, syrups, and soft drinks.

<h3>What food is in carbohydrates?</h3>

A vast variety of both good and bad foods, including bread, beans, milk, popcorn, potatoes, cookies, spaghetti, soft drinks, corn, and cherry pie, include carbohydrates. They can take on various shapes as well. It is prevalent and plentiful in starches, fibers, and sugars.

<h3>What are examples of the three types of carbohydrates?</h3>

The three forms of carbohydrates—sugar, starch, and fiber—often referred to as simple or complex carbohydrates, each has a role in your diet. Sugar is a simple carbohydrate made up of mono- and disaccharides. Polysaccharides are complex carbohydrates, which include fiber and starches.

To learn more about carbohydrates visit:

brainly.com/question/14614055

#SPJ4

3 0
2 years ago
Other questions:
  • What is it called when vesicles are used to move substances into a cell
    8·2 answers
  • Pathogens include all but which one of the following? disease-causing bacteria, helpful bacteria found in the gut, viruses, micr
    10·1 answer
  • because a monoglyceride molecule has more carbon atoms than a glucose molecule, you can assume that...
    6·2 answers
  • If an average person produces 2 million red blood cells per second, how many red blood cells will be produced in a 24 hour perio
    5·1 answer
  • Greatest diffrence between cells of a baby gorilla and the cells of an adult gorilla
    5·1 answer
  • Fossil fuels deep in the earth act as a carbon reservoir, storing it for millions 1 point
    7·1 answer
  • What is the difference between biotic and abiotic limiting factors?
    15·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • I'm at school and I need help <br><br><br> 100points for the answer
    10·2 answers
  • Give reason why classification of animals is done.​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!