1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jok3333 [9.3K]
3 years ago
5

Please help me i’ll give brainlist

Biology
2 answers:
butalik [34]3 years ago
8 0
Bbbbbbbbbbbbbbbbbbbbbbbb
inysia [295]3 years ago
7 0

Answer:

B

Explanation:

You might be interested in
How do cells in animals (i.e., birds, horses, humans, etc.) get energy?
WITCHER [35]

Answer:

Explanation:

its easy study it

7 0
4 years ago
Which structure in this plant cell represents the site of ATP production from photosynthesis?
oksian1 [2.3K]

The plant cell referred to in the question is attached to this answer.

The structure in the plant cell that represent the sites of ATP production from photosynthesis is the CHLOROPLAST; THAT IS OPTION B.

The photosynthesis reaction is divided into two stages, which are the light reaction and the dark reaction. The light reaction takes place in during the day in the presence of sunlight and it is during this period that ATP molecules are formed in the stroma of the chloroplast. During the dark reaction, the ATP produced during the light reaction together with NADPH are used as source of energy and reducing power respectively to manufacture carbohydrate from carbon dioxide.

Download docx
6 0
3 years ago
1. What process do plants undergo to produce chemical energy?
egoroff_w [7]
They undergo photosynthesis by converting solar energy to chemical energy :p
5 0
4 years ago
Read 2 more answers
Infants learn to control their elbows and knees before their hands and feet which illustrates the
Luden [163]
Cephalocaudal pattern of motor development
4 0
3 years ago
If a plant has the phenotype of the dominant trait of having thorns, then the plant has either the genotype Tt or tt.
pshichka [43]
If a plant has the phenotype of the dominant trait of having thorns then it will have TT because T is the dominant when the t is the recessive. so the answer to this is false. The genotype should be TT.
4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the main type of energy used to help convert metamorphic rocks into igneous rocks in the rock cycle
    14·1 answer
  • Which characteristics must an object possess in order to be considered alive?​
    15·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which best illustrates the importance of DNA technology?
    7·2 answers
  • The chemical reactions involved in respiration are virtually identical between prokaryotic and eukaryotic cells. In eukaryotic c
    11·1 answer
  • Mason drew the cladogram shown. Which statements best describes the cladogram? Select three options. (HURRY I WILL MARK BRAINLIE
    15·1 answer
  • Hey, I need help with biology. Thanks.
    8·1 answer
  • How do we make a new gene
    9·1 answer
  • Whats the Location for Postsynaptic
    12·1 answer
  • Dead cells with narrow lumen, lignified cell wall with a few or
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!