1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sashaice [31]
4 years ago
6

Why is a protozoan considered animal-like? It is a heterotroph. It is multicellular. It has a flagellum. It has a cell wall.

Biology
1 answer:
butalik [34]4 years ago
5 0

Answer:

The answer  was A

It's a Heterotroph

It's means they eat thing outside of themselves instead of producing their own food.

I believe it's correct

Explanation:

You might be interested in
Most coastal areas on Earth experience two high tides and two low tides every lunar day. What is a lunar day? Our days on Earth
ahrayia [7]

The correct answer is - C) 5:35 PM Friday.

The low tides occur twice in a lunar day, thus they are diurnal. The low tides appear when the Moon is between that point of the planet and the opposite of that point of the planet, thus in between, which is happening twice, on opposite parts of the planet.

Since the lunar day lasts for 24 h 50 m, we should just divide it in two, thus get 12 h 25 m. Than we should add the 12 h 25 to the time when one of the low tides appeared, which is 5:10 AM, so we will get 5:35 PM.

The low tides appear because the Moon is pulling the water upwards with its gravitational pull above the place where it is, so the side parts of the planet have their waters dragged away,thus resulting in the retreating of the water, known as low tide.

3 0
3 years ago
Read 2 more answers
What makes essential fatty acids amino acids different from ones that arent essential?
Svetlanka [38]

Answer:

\rB. nutrients that are essential cannot be made by the body, so they must be obtained from food.

Explanation:

If we look at the definition of essential fatty acids, it clearly states that these are fats which human body cannot prepare but are essential for proper functioning of body. Since body cannot synthesize them on their own, therefore we must obtain them through a diet rich in them. Two main essential fatty acids are:

  • Alpha-linolenic acid (omega-3)
  • linoleic acid (omega-6)

They play essential functions in body sucg as :

Production of hormones

Better adrenal and thyroid activity

Regulation of inflammatory and immune responses, function and development of brain.

Supporting the development of healthy skin and hair.

Option B is the best option.

Hope it helps!

Thank you

3 0
4 years ago
What metaphor best describes evolution A) random or chaos B)an improve comes routine or C) An architect building from blueprints
galina1969 [7]

Answer: B

Explanation:

Evolution is a process of elimination.  the traits that are successful and help them survive are kept for the next population, because they are abet o survive to repopulate.  So its improvement.  

8 0
4 years ago
Which of the following is a bacterium?
andrezito [222]
A and b are cells so they definitely are not bacterium so c and d are bacterium I think. Your welcom.
4 0
3 years ago
Read 2 more answers
One kind evidence that supports Wagner's hypothesis is that
anyanavicka [17]

Answer:

Wegener used evidence of climate change to support his hypothesis

7 0
3 years ago
Other questions:
  • What type of reproduction shuffles the genes
    5·2 answers
  • Human cells normally have 46 chromosomes. For each of the following stages, state the number of chromosomes present in the parti
    13·1 answer
  • What carries electrical messages to the brain?
    5·1 answer
  • Urine produced in the kidneys is carried to the bladder through a pair of tubes called _____.Select one of the options below as
    15·1 answer
  • Which statement best describes the relationship between organism X and organism Yin each interaction?
    5·1 answer
  • When watering her plants, Stela adds enough water to the soil to completely wet it. How will this help in plant growth?
    11·1 answer
  • A salt is formed by the ionic bonding of a cation and an anion true or false
    6·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Fossil fuels can usually be found in layers of what?
    7·2 answers
  • 29 pt and brainlyyyyyy​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!