1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bezzdna [24]
3 years ago
8

The medications used in the treatment of PTSD _________ a) are used to alter the stressful situation. b) act to minimize the cog

nitive response to the stressor. c) provide the client with a temporary escape from the trauma. d) provide minimal benefits for treating PTSD.
Biology
2 answers:
noname [10]3 years ago
5 0

Answer. A

Explanation: The medications used in the treatment of PTSD helps to alter stressful situations in people with PTSD. These medications includes:

1. Antidepressants which helps symptoms of depression and anxiety.

2. Prazosin which helps to reduce nightmares in people with PTSD

diamong [38]3 years ago
5 0

Answer:

d) provide minimal benefits for treating PTSD.

Explanation:

Post-traumatic stress disorder (PTSD) is a type of anxiety perceived in people who have been victims or who have witnessed acts of extreme violence. These acts end up causing psychic, physical and emotional changes in people to the point that they are unable to live a normal life and need psychiatric monitoring.

In many situations, PTSD victims need to treat this disorder with the use of medications. However, the drugs used to treat PTSD provide minimal benefits for the treatment of PTSD. This is because people with this disorder are in a constant state of stress, feel that they are threatened at all times, making them always ready to fight or flee. Medicines suppress these sensations, causing mental wear and tear in individuals, which can make them apathetic, depressive.

You might be interested in
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
One of the reasons for the success of the smallpox eradication campaign was that
Pavlova-9 [17]
One of the reasons for the success of the smallpox eradication campaign was that small pox only occurred in humans. Smallpox is an extremely contagious and deadly virus for which there is no known cure. it is caused by two variants, Variola major and Variola minor. it is a disease of the past that was eliminated by worldwide vaccination. 
4 0
3 years ago
The epidermis is the most superficial layer of the skin. It is composed of stratified squamous epithelium. Within the epidermis,
son4ous [18]

Answer:

a. Stratum corneum 5. : Thick superficial layer of flat, keratinized, dead cells; responsible for dandruff.

b. Stratum granulosum 3.: Cells flatten and fill with keratin, resulting in a grainy appearance.

c. Stratum lucidum 4. : Clear layer found only in thick skin; cells full of keratin.

d. Stratum basale 1. : Deepest layer; site of rapid cell division and melanin production.

e. Stratum spinosum 2.: Live keratinocytes connected by desmosomes produce pre-keratin

Explanation:

The epidermis has five layers, starting from the deepest one they are:

The stratum basale: is the layer that has the germinative cells, called keratinocytes.

The stratum spinosum: the keratinocytes are connected, and they produce the precursor of keratin and lipids.

The stratum granulosum: the name of this stratum is due to the appearance of the cells. They produce keratohyalin, and the lipids produced in the previous layer are released, creating the layer that protects the skin against dehydration.

The stratum lucidum: They are only in thick skin, like the one that is in the sole of our feet. The cells do not have a nucleus. They are filled with keratin, which is the component of thick skin.

The stratum corneum: the more superficial layer, it is made of dead cells filled with keratine. When new cells ascend to this stratum, the old ones have to be removed by exfoliation or natural peeling.

4 0
3 years ago
The thee parts of the Cell Theory are
Molodets [167]

Answer:

Cells come from other living cells

All living things are composed of one or more cells

The cell is the basic unit of life.

4 0
3 years ago
Read 2 more answers
Why does the method of building a sustainable lobster fishery with casitas require additional improvements to be considered effe
Crank
B hope this helped ☺️!!!
8 0
3 years ago
Other questions:
  • Why do scientists stain cells
    7·2 answers
  • If we increase energy, what happens to temperature ?
    11·2 answers
  • Explain why Triethanolamine is a polar molecule. What can you do to make this molecule less soluble in lipids?
    8·1 answer
  • Koro is a culture-related disorder that is common among individuals residing in _____.
    8·1 answer
  • BRAINLIEST TO WHOEVER ANSWERS THE LAST TWO QUESTIONS IVE ASKED THANK YOU (you also get a lot of points)
    14·2 answers
  • What results when coronary circulation is prevented in humans?
    15·1 answer
  • HELPPPP!!! <br> G:Green <br> B:Blue <br> -what percent of the offspring will have green skin???-
    6·1 answer
  • Tell us one way that saturated fats and unsaturated fats are different.
    9·1 answer
  • How did the importance of food poisoning by Campylobacter change between<br> 1991 and 2008?
    14·1 answer
  • Why is sunlight important for life on earth
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!