1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
larisa [96]
3 years ago
9

What is catastrophism

Biology
1 answer:
scoray [572]3 years ago
4 0

the theory that changes in the earth's crust during geological history have resulted chiefly from sudden violent and unusual events.

You might be interested in
According to the image above, the four species share _______ structures which indicates that they all share a _______ ancestor.
irina [24]

Answer:

homologous, high levels of, natural selection

3 0
4 years ago
Read 2 more answers
Which of the following organisms is likely to be in the lowest trophic level
Zielflug [23.3K]

Answer:

plankton

Explanation:

plankton are eaten by pretty much everything as they are so small. they also get food through photosynthesis therefore they do not eat any other animals. i am pretty certain krill eat them but i dont know

7 0
2 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
The respiratory system branches like the circulatory. Oxygen and carbon dioxide diffuse between the end of these branches and th
Feliz [49]

Answer:

1. Ends of the respiratory branches are called alveoli.

2. C. To control blood flow to different areas of the body depending on activities

Explanation:

1. The trachea divides into left and right primary bronchi which in turn divide multiple times upon entering the lungs and make the bronchial tree.

The final branches of the bronchial tree are the terminal bronchioles that lead to alveoli. The alveoli are the balloon-shaped structures and serve as the site of gas exchange between the blood and inhaled air.  

2. The opening and closing of sphincters of capillary beds regulate the direction of blood flow. The opening of sphincters allows the blood to flow into associated branches of capillary beds while closed sphincters direct the blood from arterioles to venules via thoroughfare channel.

This local change in blood flow is responsible for the autoregulation of blood flow to different tissues to match their respective metabolic demands. For example, during physical activity, more blood is directed to skeletal and cardiac muscles.

8 0
3 years ago
The sole of a gecko's foot is covered with millions and millions of small, dry "hairs" that make direct contact with surfaces, a
tamaranim1 [39]

Answer: Van der Waals forces

Explanation:

Van der Waals forces are weak intermolecular forces that depend on the distance between two particles. They are caused by correlations in the change in polarization between two nearby particles. To put it in other words, when a particle changes its polarization (becomes more positive on one end and more negative on the other), so does the adjacent particle, and the next one, and so on. This causes these particles to stick together weakly.

The tiny "hairs" increase the surface area of the gecko's feet in contact with the wall, which makes the bond stronger and allows it to support all of its weight.

Because experiments have shown that geckos stick well to both hydrophobic and hydrophilic surfaces, we can assume there aren't any hydrogen bonds present.

Ionic bonds can't be present either because geckos wouldn't stick to electrically neutral surfaces, as these bonds require charged molecules.

6 0
3 years ago
Other questions:
  • As part of an experiment to measure decomposition rates of different materials, students put food scraps from the cafeteria in c
    14·1 answer
  • How does cardiovascular system help the body maintain homeostasis?
    13·2 answers
  • The tails of the phospholipid bilayer face away from water because they are *
    14·1 answer
  • A slow reproduction process is a disadvantage of which form of reproduction
    12·2 answers
  • Meioses is similar to Mitoses. True or false?
    7·1 answer
  • Please answer fast I need the answer by 11.00pm tonight
    9·1 answer
  • Which of the following best describes how amino acids affect the tertiary structure of a protein?
    15·1 answer
  • Help me pls and thank you​
    11·1 answer
  • What is the purpose of the code in DNA?
    13·1 answer
  • which sentence uses the proper MLA style for an in-text citation with an attributive phrase ? (a) IN a recent study,titled Home
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!