1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
levacccp [35]
3 years ago
11

The process of binary fission is shown above. Which of the following cells would be most likely to undergo this type of reproduc

tion?. . A. bacterial cell . . B. red blood cell . . C. oak tree leaf cell . . D. sperm cell . . . . . . .
Biology
2 answers:
Alona [7]3 years ago
6 0

The correct answer is A. bacterial cell.

Naddik [55]3 years ago
5 0
A. Bacterial cells would undergo this type of reproduction, Binary Fission. An asexual reproductive process where a single bacterium splits into 2 additional bacteria, each having the same bacterial DNA and or genome as the original bacterium.
You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
bedbugs are parasites? Explain your reasoning using what you’ve learned about parasitic relationships.
velikii [3]

Explanation:

Bedbugs are parasites that rely on blood to survive. They can feed on the blood of any mammal, although they appear to prefer the blood of humans. They are attracted to the warmth surrounding mammalian bodies and the carbon dioxide present in breath expiration. It is usually these factors that guide bedbugs to locate a suitable host for feeding. DOES THIS HELP?

5 0
3 years ago
Read 2 more answers
The fast and long-distance movement of mitochondria along the axon of animal nerve cells is thought to be facilitated mainly by
Citrus2011 [14]
B is the answer hope that helps
4 0
2 years ago
Lead enters the atmosphere as a particulate pollutant. this is a problem because it ________. select one:
cluponka [151]
C causes central nervous system damage to humans
5 0
3 years ago
Regardless of an object's position in space, its _______ remains constant.
777dan777 [17]
It’s mass stays constant .weight changes depending on gravitational force
8 0
3 years ago
Read 2 more answers
Other questions:
  • Nancy is taking a walk after dinner in her garden. She finds moths hovering around some flowers. Which flower characteristics at
    12·1 answer
  • Why is it important that our understanding of social science concepts continue to develop and expand?
    9·1 answer
  • Do you think acid rain is harmful
    6·1 answer
  • The ___ chromosome is the sex determiner for many species<br><br> a. Female <br> b. Male
    8·2 answers
  • Which of the following is the correct sequence of events in the origin of life? I. Formation of protocells II. Synthesis of orga
    8·2 answers
  • Birth defects can be caused by:
    7·2 answers
  • Other than using financial aid options offered to him what are some creative ways he can make ends meet
    11·1 answer
  • You are studying a biochemical pathway and isolate mutants I, II, and III. Mutant I can grow if you supplement the medium with Z
    15·1 answer
  • Would the left or right ventricles of the pig heart have more cardiac muscle? explain.
    10·1 answer
  • Which is not true about plant cell walls?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!