1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OlgaM077 [116]
3 years ago
14

Products and components to other products are made on complex conveyor belts that run along the factory floor. There are two typ

es of conveyor belts in this factory. One type of conveyor belt has many complex machines working along it; the machines are very efficient but only make a few types of products. This type of conveyor belt represents the_____________.
Biology
1 answer:
dimaraw [331]3 years ago
3 0

Answer:

The answer is rough endoplasmic reticulum.

Explanation:

If we apply this analogy to the cellular structures, the type of conveyor belt explained in the question represents the rough endoplasmic reticulum. Because it has a complex structure made up of membrane and ribosomes and it produces only a limited number of proteins just like the very efficient conveyor belt that produces only a few products.

I hope this answer helps.

You might be interested in
Which of these would not be considered an invasive species?
Marysya12 [62]

Answer:

C) In 1946, the Argentinian government imported fifty beavers from Canada, which were to be released in Cami Lake with the intention of creating a commercial fur trading industry. Though a viable industry ultimately failed to materialize, the introduction of the beavers into the region has had far-reaching consequences.

7 0
3 years ago
If an enzyme in solution is saturated with substrate, the most effective way to obtain a faster yield of products is to:a. add m
Simora [160]

Answer:

a. add more of the enzyme

Explanation:

Enzymes have specific sites to which their substrates bind during the reaction. These sites are called active sites. When all the active sites of all the enzyme molecules present in a solution are bound to the substrate molecules, the enzyme is said to be saturated with the substrate. Under these conditions, more enzyme molecules are to be added to the solution to increase the reaction rate and to obtain the product at a fast rate. The addition of more enzymes will allow more substrate molecules to occupy the active sites and to be converted into the product/s.

4 0
3 years ago
The placing of information or objects into groups based on certain similarities is_____
bearhunter [10]

Answer:

B.) classification

Explanation:

In biology, classification is a way to organize living things. In science generally, this could expand to include any type of object.

4 0
2 years ago
DNA compaction into chromosomes is dependent upon a family of proteins called histones. These essential DNA organization protein
irinina [24]

Answer:

Explanation:

The history protein H2A, H2B, H3 and H4 forms an octamer ( 2 each of the four histones) around which the DNA is wrapped. They help in packaging the DNA allowing for compaction of the DNA

Linker histone H1 and a length of DNA (linker DNA) links two nucleosomes together and they also play essential role in chromatin strucrure, stabilizing it and also modulating accessibility of the DNA to biological processes.

8 0
3 years ago
How have microscopes led to the evolution of science?
saul85 [17]
It has helped us by seeing what kind of things we can see with our eyes it also helps us by seeing mirco things like dirt
3 0
2 years ago
Other questions:
  • Simplify 7 +4.5. a 55 b 6 c 27 d 16​
    10·1 answer
  • Which term identifies the process used by the cell to bring in large molecules?
    9·2 answers
  • Which of the following is not true of lymphatic capillaries?
    8·1 answer
  • When certain traits increase the likelihood of an animal living a long life it is referred to as
    11·1 answer
  • Imagine you do DNA fingerprinting in a forensics lab. You obtain six
    9·2 answers
  • A molecule that enters the body from an external source and alters its normal functions is a(an) A molecule that enters the body
    13·1 answer
  • Are cell membranes in plant or animals or both?
    10·1 answer
  • Explain what you would have to do to the date on your watch if you were tocross over the International Date Line from east to we
    11·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Which statement best explains the process of transcription as it relates to protein synthesis and gene expression?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!