1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enyata [817]
3 years ago
15

Due to the cardiovascular health-related benefits of essential fatty acid consumption, what does the American Heart Association

recommend for omega-6 fatty acid consumption?
Biology
1 answer:
nata0808 [166]3 years ago
8 0

OPTIONS:

A. 1% to 2% of total calories

B. 3% to 4 % of total calories

C. 5% to 10% of total calories

D. Up to 15% of total calories

Answer:

C. 5% to 10% of total calories

Explanation:

Contrary to the misconception that consuming food that has omega-6 fatty acids is unhealthy and might increase the chances of one developing cardiovascular problem, the American Heart Association in its journal, refute such unfounded claim, while recommending <em>a daily consumption of 5% to 10% of total calories, from omega-6 fatty acids, or 12 to 22 grams per day</em>. According to the AHA, omega-6 fatty acids, which are polysaturated fatty acids, are safe and beneficial to the heart. Foods like nuts, seeds, vegetable oils, salad dressing contain omega-6 fatty acids, which may reduce risk for cardiovascular diseases.

You might be interested in
How is climate change relate to Environmental science
ankoles [38]

Answer:

Explanation:

Well, climate change is directly related to the environment. It effects everything around us, such as animals, plants, the ozone layer, different climates, etc.

3 0
3 years ago
What two types of organic molecules make up carbohydrates?
Bingel [31]

Answer:

carbon and hydrogen

Explanation:

Have a nice day

3 0
2 years ago
Which enzyme unzips or unwinds the two dna strands away from each other?
alexandr1967 [171]

Answer:

Helicase

Explanation:

5 0
3 years ago
The level occupied by the wolf at the top of this energy pyramid is a ____________ _____________.
Leya [2.2K]

Answer:

不,你做

Explanation:

There's the answer you know what to use to get the answer

7 0
3 years ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Other questions:
  • Hazard mitigation is most effective when it takes place after disasters. <br> a. True <br> b. False
    15·1 answer
  • Is there any one who is preparing fo medical entrance exam
    14·1 answer
  • Orcas, or killer whales, are natural predators of sea otters. It has been observed that in regions where the sea otters are not
    7·1 answer
  • The structure identified in the image above is called the ​
    14·2 answers
  • Earth’s magnetism is related to the circulation of molten material within Earth’s core.
    7·2 answers
  • 13. This diagram shows which cellular process?
    5·1 answer
  • PLZ hELp!!!!!!!!!!!!
    7·1 answer
  • dos semejanzas y tres diferencias, entre los postulados griegos, y los postulados de Van Helmont y Needham de las teorías abioge
    7·1 answer
  • Where a stream leaves a mountain range youll find an?​
    8·1 answer
  • How many heart does a human have?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!